\
| Variant ID: vg0906525232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6525232 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCTTTCTTGCCACCTCCTCTTGCATGCTAAGCTCGTAGTTCGATACCTTGTACTCAAGATCTGCAATTTTTGCCTCAGTATTTCTCTTGCTCCTCATCCG[A/G]
CTCCTGTACGTATGGATGTCCTCCATGAATCCAATCTTCCAAGGAACCACGCCTTTCCCTCGTGTTCGTCCTGGATGCTCGAGAGTCTGTAGGGCGAGTG
CACTCGCCCTACAGACTCTCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGGTTCCTTGGAAGATTGGATTCATGGAGGACATCCATACGTACAGGAG[T/C]
CGGATGAGGAGCAAGAGAAATACTGAGGCAAAAATTGCAGATCTTGAGTACAAGGTATCGAACTACGAGCTTAGCATGCAAGAGGAGGTGGCAAGAAAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 22.40% | 4.38% | 20.99% | NA |
| All Indica | 2759 | 25.40% | 32.00% | 7.39% | 35.12% | NA |
| All Japonica | 1512 | 98.50% | 0.50% | 0.00% | 0.99% | NA |
| Aus | 269 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 33.90% | 4.50% | 5.88% | 55.63% | NA |
| Indica II | 465 | 18.50% | 54.00% | 3.66% | 23.87% | NA |
| Indica III | 913 | 19.90% | 36.60% | 11.72% | 31.76% | NA |
| Indica Intermediate | 786 | 29.50% | 34.60% | 5.73% | 30.15% | NA |
| Temperate Japonica | 767 | 99.30% | 0.40% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 97.00% | 0.40% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 24.40% | 3.33% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906525232 | A -> G | LOC_Os09g11690.1 | synonymous_variant ; p.Ser113Ser; LOW | synonymous_codon | Average:41.628; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0906525232 | A -> DEL | LOC_Os09g11690.1 | N | frameshift_variant | Average:41.628; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906525232 | NA | 5.82E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | NA | 1.60E-09 | mr1232_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | NA | 1.61E-07 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | NA | 7.70E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | NA | 2.17E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | NA | 8.52E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | NA | 4.36E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906525232 | 3.45E-06 | 3.45E-06 | mr1947_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |