Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906523974:

Variant ID: vg0906523974 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6523974
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTGGACGTTCTGATCCTCGTTCCGATCACCTCTCTACCGTTGGCAATCATTTCCATTTACTGTTCATGGAATCGGTACATATGTGTCAGTAGGGACTT[T/C]
AGCTGCTCAGGCTTGACAAGCGGTTTACCGAGTTCGAACTAGTATTTCACTTCCACCGTTGGGATTGATGCGCCTTTAAGCAACTGAGTCCTAGTTAGTC

Reverse complement sequence

GACTAACTAGGACTCAGTTGCTTAAAGGCGCATCAATCCCAACGGTGGAAGTGAAATACTAGTTCGAACTCGGTAAACCGCTTGTCAAGCCTGAGCAGCT[A/G]
AAGTCCCTACTGACACATATGTACCGATTCCATGAACAGTAAATGGAAATGATTGCCAACGGTAGAGAGGTGATCGGAACGAGGATCAGAACGTCCAACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.90%	30.70%	2.64%	24.71%	NA
All Indica	2759	19.10%	35.20%	4.35%	41.36%	NA
All Japonica	1512	81.70%	17.30%	0.00%	0.99%	NA
Aus	269	41.30%	58.00%	0.74%	0.00%	NA
Indica I	595	8.10%	26.90%	3.53%	61.51%	NA
Indica II	465	38.70%	32.30%	5.38%	23.66%	NA
Indica III	913	11.50%	40.20%	5.59%	42.72%	NA
Indica Intermediate	786	24.70%	37.40%	2.93%	34.99%	NA
Temperate Japonica	767	93.00%	6.80%	0.00%	0.26%	NA
Tropical Japonica	504	82.50%	14.90%	0.00%	2.58%	NA
Japonica Intermediate	241	44.40%	55.60%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	43.80%	1.04%	0.00%	NA
Intermediate	90	61.10%	23.30%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906523974	T -> DEL	N	N	silent_mutation	Average:29.374; most accessible tissue: Callus, score: 51.166	N	N	N	N
vg0906523974	T -> C	LOC_Os09g11680.1	upstream_gene_variant ; 3726.0bp to feature; MODIFIER	silent_mutation	Average:29.374; most accessible tissue: Callus, score: 51.166	N	N	N	N
vg0906523974	T -> C	LOC_Os09g11690.1	downstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:29.374; most accessible tissue: Callus, score: 51.166	N	N	N	N
vg0906523974	T -> C	LOC_Os09g11700.1	downstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:29.374; most accessible tissue: Callus, score: 51.166	N	N	N	N
vg0906523974	T -> C	LOC_Os09g11680-LOC_Os09g11690	intergenic_region ; MODIFIER	silent_mutation	Average:29.374; most accessible tissue: Callus, score: 51.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906523974	NA	3.14E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906523974	3.44E-06	NA	mr1692	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906523974	NA	2.28E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906523974	NA	9.81E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906523974	NA	3.93E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906523974	NA	1.67E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251