\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906478875:

Variant ID: vg0906478875 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6478875
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGCCCGAGTACATTCGACGCTTCCGAGATCTTTGATAAGCTAAGAGTTGCTCTGGATACATATTTCAAGAACATCAAAGAAGCCGGAAGTATGGGAGC[A/G]
AGTCTAGCGTTGGCGATGACCAAATCCCTTTACCCGAAAATCGACATTGATGCCGTTGATGGCTTTGCGGACGGGACGAGCGAAGAAGCTGCTCTCGATC

Reverse complement sequence

GATCGAGAGCAGCTTCTTCGCTCGTCCCGTCCGCAAAGCCATCAACGGCATCAATGTCGATTTTCGGGTAAAGGGATTTGGTCATCGCCAACGCTAGACT[T/C]
GCTCCCATACTTCCGGCTTCTTTGATGTTCTTGAAATATGTATCCAGAGCAACTCTTAGCTTATCAAAGATCTCGGAAGCGTCGAATGTACTCGGGCCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 8.40% 2.48% 13.44% NA
All Indica  2759 69.10% 5.40% 3.30% 22.22% NA
All Japonica  1512 98.90% 0.20% 0.13% 0.79% NA
Aus  269 27.10% 65.10% 7.06% 0.74% NA
Indica I  595 59.70% 0.20% 3.36% 36.81% NA
Indica II  465 64.70% 8.20% 4.73% 22.37% NA
Indica III  913 76.20% 5.70% 3.40% 14.68% NA
Indica Intermediate  786 70.60% 7.30% 2.29% 19.85% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 94.60% 0.40% 0.83% 4.15% NA
VI/Aromatic  96 29.20% 65.60% 3.12% 2.08% NA
Intermediate  90 82.20% 8.90% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906478875 A -> G LOC_Os09g11600.1 synonymous_variant ; p.Ala668Ala; LOW synonymous_codon Average:28.791; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N
vg0906478875 A -> DEL LOC_Os09g11600.1 N frameshift_variant Average:28.791; most accessible tissue: Zhenshan97 young leaf, score: 59.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906478875 NA 1.77E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 1.87E-06 1.69E-10 mr1310 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 6.15E-13 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 5.70E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 4.12E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 9.95E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 1.76E-08 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 1.26E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 2.48E-06 mr1049_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 2.51E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 8.03E-06 1.96E-10 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 2.26E-10 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 4.72E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 2.41E-11 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 5.38E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 4.96E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906478875 NA 8.44E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251