\
| Variant ID: vg0906477614 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6477614 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 72. )
GGAAACCATCTGATATAGATCCTTCTGGAAAGGACTCTGATCCGGCTAATATGGAAACAAGTTCTTCCAAAGAAACCGGGCCGACTGCTGAGGATCATCC[G/A]
AGTGACAATCAGCTGGCAACCGATAATGTAGAATCCAGCAATCAACCCCCGACCGGAAACCAGTTTGCCGAAGCTGAAGCCAGAGTCAATCAGGAGCCCC
GGGGCTCCTGATTGACTCTGGCTTCAGCTTCGGCAAACTGGTTTCCGGTCGGGGGTTGATTGCTGGATTCTACATTATCGGTTGCCAGCTGATTGTCACT[C/T]
GGATGATCCTCAGCAGTCGGCCCGGTTTCTTTGGAAGAACTTGTTTCCATATTAGCCGGATCAGAGTCCTTTCCAGAAGGATCTATATCAGATGGTTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.30% | 10.70% | 1.86% | 41.16% | NA |
| All Indica | 2759 | 22.10% | 7.00% | 2.54% | 68.39% | NA |
| All Japonica | 1512 | 98.30% | 0.40% | 0.20% | 1.12% | NA |
| Aus | 269 | 11.90% | 79.60% | 2.60% | 5.95% | NA |
| Indica I | 595 | 32.90% | 0.70% | 1.51% | 64.87% | NA |
| Indica II | 465 | 15.90% | 9.00% | 3.87% | 71.18% | NA |
| Indica III | 913 | 14.50% | 8.70% | 1.86% | 75.03% | NA |
| Indica Intermediate | 786 | 26.30% | 8.70% | 3.31% | 61.70% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 92.10% | 1.70% | 0.83% | 5.39% | NA |
| VI/Aromatic | 96 | 5.20% | 87.50% | 4.17% | 3.12% | NA |
| Intermediate | 90 | 60.00% | 11.10% | 4.44% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906477614 | G -> DEL | LOC_Os09g11600.1 | N | frameshift_variant | Average:29.389; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0906477614 | G -> A | LOC_Os09g11600.1 | synonymous_variant ; p.Pro413Pro; LOW | synonymous_codon | Average:29.389; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906477614 | 2.81E-06 | 1.04E-09 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 1.22E-13 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 2.06E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 1.08E-10 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 7.65E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 3.69E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 5.26E-08 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 1.25E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | 1.07E-06 | 3.33E-11 | mr1310_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 2.91E-12 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 1.84E-13 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 5.34E-08 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906477614 | NA | 3.71E-10 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |