Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906472621:

Variant ID: vg0906472621 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6472621
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.24, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCATGGAAATTATATATTGTGCTGAGTGCACACAAAAATGCAATTAGGAGAGAGCAAACTCATATTAACGATTACATAGTTGCATGCGTCTCCTAGCA[C/T]
TTTTCGGGATTAATCCTATTAAGTCCCATATTTCGAATTATTTTCTCTTAATCCCCTCCAATGCTCTCCGATCCCCTACAAAACAAACAAGGCCTAAGGC

Reverse complement sequence

GCCTTAGGCCTTGTTTGTTTTGTAGGGGATCGGAGAGCATTGGAGGGGATTAAGAGAAAATAATTCGAAATATGGGACTTAATAGGATTAATCCCGAAAA[G/A]
TGCTAGGAGACGCATGCAACTATGTAATCGTTAATATGAGTTTGCTCTCTCCTAATTGCATTTTTGTGTGCACTCAGCACAATATATAATTTCCATGGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.90%	33.10%	0.25%	32.80%	NA
All Indica	2759	9.60%	41.20%	0.33%	48.86%	NA
All Japonica	1512	84.00%	14.70%	0.00%	1.26%	NA
Aus	269	4.50%	46.10%	0.37%	49.07%	NA
Indica I	595	7.70%	24.70%	0.50%	67.06%	NA
Indica II	465	12.00%	53.80%	0.43%	33.76%	NA
Indica III	913	7.40%	41.80%	0.11%	50.60%	NA
Indica Intermediate	786	12.10%	45.50%	0.38%	41.98%	NA
Temperate Japonica	767	95.30%	4.70%	0.00%	0.00%	NA
Tropical Japonica	504	84.90%	14.70%	0.00%	0.40%	NA
Japonica Intermediate	241	46.10%	46.90%	0.00%	7.05%	NA
VI/Aromatic	96	13.50%	50.00%	0.00%	36.46%	NA
Intermediate	90	46.70%	33.30%	2.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906472621	C -> DEL	N	N	silent_mutation	Average:40.688; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0906472621	C -> T	LOC_Os09g11580.1	upstream_gene_variant ; 3811.0bp to feature; MODIFIER	silent_mutation	Average:40.688; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0906472621	C -> T	LOC_Os09g11600.1	upstream_gene_variant ; 3629.0bp to feature; MODIFIER	silent_mutation	Average:40.688; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0906472621	C -> T	LOC_Os09g11590.1	downstream_gene_variant ; 2082.0bp to feature; MODIFIER	silent_mutation	Average:40.688; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0906472621	C -> T	LOC_Os09g11590-LOC_Os09g11600	intergenic_region ; MODIFIER	silent_mutation	Average:40.688; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906472621	NA	4.45E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	3.46E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	8.27E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	3.57E-06	mr1137_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	6.77E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	2.25E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	1.08E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	2.26E-06	NA	mr1827_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906472621	NA	1.52E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251