\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906451223:

Variant ID: vg0906451223 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 6451223
Reference Allele: CAlternative Allele: T,CAT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATAACTTTTCCTAATGATCAGAATATCCTCCAAGAAACCCTATCCACATCTAATCCTATCCATTCAGATTAACCCTATCCATTCATCTCTCGTATCT[C/T,CAT]
GTCTCTCTCTCTCTCGACTAGTGACGGCGGCGGCGTCTCATTGTAACTCTGATACACTGTAATATGCTGGATGGTGGAGGAGCGCCTGTAATCAGTACCC

Reverse complement sequence

GGGTACTGATTACAGGCGCTCCTCCACCATCCAGCATATTACAGTGTATCAGAGTTACAATGAGACGCCGCCGCCGTCACTAGTCGAGAGAGAGAGAGAC[G/A,ATG]
AGATACGAGAGATGAATGGATAGGGTTAATCTGAATGGATAGGATTAGATGTGGATAGGGTTTCTTGGAGGATATTCTGATCATTAGGAAAAGTTATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 10.70% 7.58% 13.65% CAT: 0.08%
All Indica  2759 71.00% 0.40% 10.84% 17.65% CAT: 0.07%
All Japonica  1512 64.00% 31.60% 1.39% 3.04% NA
Aus  269 63.60% 0.00% 7.81% 27.88% CAT: 0.74%
Indica I  595 90.60% 0.20% 6.89% 2.35% NA
Indica II  465 52.70% 0.20% 16.34% 30.75% NA
Indica III  913 69.40% 0.50% 10.62% 19.17% CAT: 0.22%
Indica Intermediate  786 68.80% 0.60% 10.81% 19.72% NA
Temperate Japonica  767 92.40% 4.60% 1.43% 1.56% NA
Tropical Japonica  504 21.00% 76.20% 1.19% 1.59% NA
Japonica Intermediate  241 63.10% 24.50% 1.66% 10.79% NA
VI/Aromatic  96 63.50% 2.10% 6.25% 28.12% NA
Intermediate  90 58.90% 17.80% 12.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906451223 C -> DEL N N silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0906451223 C -> T LOC_Os09g11560.1 upstream_gene_variant ; 1375.0bp to feature; MODIFIER silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0906451223 C -> T LOC_Os09g11550.1 downstream_gene_variant ; 1235.0bp to feature; MODIFIER silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0906451223 C -> T LOC_Os09g11550-LOC_Os09g11560 intergenic_region ; MODIFIER silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0906451223 C -> CAT LOC_Os09g11560.1 upstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0906451223 C -> CAT LOC_Os09g11550.1 downstream_gene_variant ; 1236.0bp to feature; MODIFIER silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg0906451223 C -> CAT LOC_Os09g11550-LOC_Os09g11560 intergenic_region ; MODIFIER silent_mutation Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906451223 NA 6.31E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.09E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 3.04E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 5.64E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 2.14E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 2.43E-18 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 5.90E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.94E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.54E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.10E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.87E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.68E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 2.84E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 2.63E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 4.14E-13 mr1398_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.17E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 9.80E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 5.88E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.09E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 2.10E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 5.14E-13 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 7.46E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 3.28E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 1.08E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 5.02E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223 NA 2.02E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251