Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906451223:

Variant ID: vg0906451223 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 6451223
Reference Allele: C	Alternative Allele: T,CAT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAATAACTTTTCCTAATGATCAGAATATCCTCCAAGAAACCCTATCCACATCTAATCCTATCCATTCAGATTAACCCTATCCATTCATCTCTCGTATCT[C/T,CAT]
GTCTCTCTCTCTCTCGACTAGTGACGGCGGCGGCGTCTCATTGTAACTCTGATACACTGTAATATGCTGGATGGTGGAGGAGCGCCTGTAATCAGTACCC

Reverse complement sequence

GGGTACTGATTACAGGCGCTCCTCCACCATCCAGCATATTACAGTGTATCAGAGTTACAATGAGACGCCGCCGCCGTCACTAGTCGAGAGAGAGAGAGAC[G/A,ATG]
AGATACGAGAGATGAATGGATAGGGTTAATCTGAATGGATAGGATTAGATGTGGATAGGGTTTCTTGGAGGATATTCTGATCATTAGGAAAAGTTATTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	10.70%	7.58%	13.65%	CAT: 0.08%
All Indica	2759	71.00%	0.40%	10.84%	17.65%	CAT: 0.07%
All Japonica	1512	64.00%	31.60%	1.39%	3.04%	NA
Aus	269	63.60%	0.00%	7.81%	27.88%	CAT: 0.74%
Indica I	595	90.60%	0.20%	6.89%	2.35%	NA
Indica II	465	52.70%	0.20%	16.34%	30.75%	NA
Indica III	913	69.40%	0.50%	10.62%	19.17%	CAT: 0.22%
Indica Intermediate	786	68.80%	0.60%	10.81%	19.72%	NA
Temperate Japonica	767	92.40%	4.60%	1.43%	1.56%	NA
Tropical Japonica	504	21.00%	76.20%	1.19%	1.59%	NA
Japonica Intermediate	241	63.10%	24.50%	1.66%	10.79%	NA
VI/Aromatic	96	63.50%	2.10%	6.25%	28.12%	NA
Intermediate	90	58.90%	17.80%	12.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906451223	C -> DEL	N	N	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0906451223	C -> T	LOC_Os09g11560.1	upstream_gene_variant ; 1375.0bp to feature; MODIFIER	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0906451223	C -> T	LOC_Os09g11550.1	downstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0906451223	C -> T	LOC_Os09g11550-LOC_Os09g11560	intergenic_region ; MODIFIER	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0906451223	C -> CAT	LOC_Os09g11560.1	upstream_gene_variant ; 1374.0bp to feature; MODIFIER	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0906451223	C -> CAT	LOC_Os09g11550.1	downstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0906451223	C -> CAT	LOC_Os09g11550-LOC_Os09g11560	intergenic_region ; MODIFIER	silent_mutation	Average:49.861; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906451223	NA	6.31E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.09E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	3.04E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	5.64E-12	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	2.14E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	2.43E-18	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	5.90E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.94E-29	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.54E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.10E-13	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.87E-14	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.68E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	2.84E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	2.63E-13	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	4.14E-13	mr1398_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.17E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	9.80E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	5.88E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.09E-10	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	2.10E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	5.14E-13	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	7.46E-07	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	3.28E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	1.08E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	5.02E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906451223	NA	2.02E-11	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251