\
| Variant ID: vg0906350119 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6350119 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )
AGATGTTGCAGGACACCAAGTAGGACTGCGAAAGTGAAAAGGGAGCCCATAAATTGGACAAGATGTTAGAGGACTACAGAACTTCGTTATACCCAGGTTG[C/T]
GAGCAGGGGCACAAAAAGTTGGATACCACTCTGGAGTTCTTGCAATGGAAGGCAAAAAATGGGGTTAGTGACAAGGCATTTGGCGATTTATTGAAACTCG
CGAGTTTCAATAAATCGCCAAATGCCTTGTCACTAACCCCATTTTTTGCCTTCCATTGCAAGAACTCCAGAGTGGTATCCAACTTTTTGTGCCCCTGCTC[G/A]
CAACCTGGGTATAACGAAGTTCTGTAGTCCTCTAACATCTTGTCCAATTTATGGGCTCCCTTTTCACTTTCGCAGTCCTACTTGGTGTCCTGCAACATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.00% | 21.10% | 4.89% | 32.99% | NA |
| All Indica | 2759 | 14.30% | 30.90% | 7.36% | 47.48% | NA |
| All Japonica | 1512 | 95.90% | 3.80% | 0.07% | 0.26% | NA |
| Aus | 269 | 9.70% | 14.50% | 7.43% | 68.40% | NA |
| Indica I | 595 | 16.10% | 15.30% | 8.74% | 59.83% | NA |
| Indica II | 465 | 8.00% | 53.80% | 3.23% | 35.05% | NA |
| Indica III | 913 | 13.90% | 25.60% | 9.64% | 50.82% | NA |
| Indica Intermediate | 786 | 17.00% | 35.20% | 6.11% | 41.60% | NA |
| Temperate Japonica | 767 | 95.60% | 4.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.50% | 8.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 16.70% | 36.50% | 3.12% | 43.75% | NA |
| Intermediate | 90 | 56.70% | 17.80% | 4.44% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906350119 | C -> DEL | LOC_Os09g11400.1 | N | frameshift_variant | Average:18.22; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0906350119 | C -> T | LOC_Os09g11400.1 | synonymous_variant ; p.Cys43Cys; LOW | synonymous_codon | Average:18.22; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906350119 | 5.16E-07 | 2.36E-11 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | NA | 3.32E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | NA | 1.38E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | 2.32E-06 | 2.76E-09 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | 1.98E-06 | 2.42E-07 | mr1550_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | 8.78E-08 | 1.34E-10 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | NA | 1.43E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | NA | 1.94E-06 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906350119 | 4.32E-06 | 4.32E-06 | mr1954_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |