\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906315696:

Variant ID: vg0906315696 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6315696
Reference Allele: CAlternative Allele: G,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, C: 0.21, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAAGGCATATTTTTTGGCCTAGGCCTAATATGTCTGCAGCCCATATTTTCAGGTGTGGCCTGTCACGTTCTTTTAGGGACTTAGGCACTTTTTGCTTA[C/G,A]
GCCAAAGTGCGCGTGATCAAGTGCCCAATACCTTAAAATCCTTTTATACCGCAGTTACTCAGCTTTTTAGGAGTTGGTACAATGCATCTTAAAAGGTGTT

Reverse complement sequence

AACACCTTTTAAGATGCATTGTACCAACTCCTAAAAAGCTGAGTAACTGCGGTATAAAAGGATTTTAAGGTATTGGGCACTTGATCACGCGCACTTTGGC[G/C,T]
TAAGCAAAAAGTGCCTAAGTCCCTAAAAGAACGTGACAGGCCACACCTGAAAATATGGGCTGCAGACATATTAGGCCTAGGCCAAAAAATATGCCTTCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 33.40% 14.05% 4.59% A: 0.04%
All Indica  2759 76.90% 10.10% 11.49% 1.45% A: 0.07%
All Japonica  1512 1.30% 82.50% 4.83% 11.38% NA
Aus  269 28.30% 1.90% 68.77% 1.12% NA
Indica I  595 70.10% 16.80% 12.10% 0.67% A: 0.34%
Indica II  465 86.00% 8.20% 4.73% 1.08% NA
Indica III  913 80.30% 7.00% 10.62% 2.08% NA
Indica Intermediate  786 72.80% 9.70% 16.03% 1.53% NA
Temperate Japonica  767 0.70% 93.20% 2.61% 3.52% NA
Tropical Japonica  504 1.00% 84.30% 2.18% 12.50% NA
Japonica Intermediate  241 3.70% 44.80% 17.43% 34.02% NA
VI/Aromatic  96 15.60% 10.40% 73.96% 0.00% NA
Intermediate  90 35.60% 42.20% 20.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906315696 C -> G LOC_Os09g11360.1 upstream_gene_variant ; 4563.0bp to feature; MODIFIER silent_mutation Average:33.586; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0906315696 C -> G LOC_Os09g11360-LOC_Os09g11370 intergenic_region ; MODIFIER silent_mutation Average:33.586; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0906315696 C -> DEL N N silent_mutation Average:33.586; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0906315696 C -> A LOC_Os09g11360.1 upstream_gene_variant ; 4563.0bp to feature; MODIFIER silent_mutation Average:33.586; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0906315696 C -> A LOC_Os09g11360-LOC_Os09g11370 intergenic_region ; MODIFIER silent_mutation Average:33.586; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906315696 NA 4.26E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 5.31E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 3.67E-06 NA mr1519 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 6.64E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 3.36E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 3.00E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 5.09E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 3.01E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 2.11E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 7.27E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 1.24E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 5.62E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 8.71E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 2.85E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 3.28E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906315696 NA 3.59E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251