\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906314868:

Variant ID: vg0906314868 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6314868
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGCCGTTGCTAATGGATGATTACGTCTTCTCCTCCGGTTGCTTCCGTCATTGCTGACTTGTTATTTCGCCCTCACGGTTGACCTACTTTGCAAACGCT[G/A,C]
ATGAGCGTCTTCGTCATTATCATCAGTTGCTACACTGCTATTGACTGGATCACCGACATCGTCATCTTCATCAATATCCTGTCAAGCCTCTTCAACATAG

Reverse complement sequence

CTATGTTGAAGAGGCTTGACAGGATATTGATGAAGATGACGATGTCGGTGATCCAGTCAATAGCAGTGTAGCAACTGATGATAATGACGAAGACGCTCAT[C/T,G]
AGCGTTTGCAAAGTAGGTCAACCGTGAGGGCGAAATAACAAGTCAGCAATGACGGAAGCAACCGGAGGAGAAGACGTAATCATCCATTAGCAACGGCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 30.40% 1.04% 6.07% C: 0.08%
All Indica  2759 45.10% 50.00% 0.94% 3.84% C: 0.14%
All Japonica  1512 84.90% 2.70% 1.32% 11.04% NA
Aus  269 94.40% 0.70% 0.37% 4.46% NA
Indica I  595 27.20% 66.70% 0.50% 5.21% C: 0.34%
Indica II  465 69.20% 30.10% 0.43% 0.22% NA
Indica III  913 38.10% 57.20% 0.88% 3.61% C: 0.22%
Indica Intermediate  786 52.40% 40.70% 1.65% 5.22% NA
Temperate Japonica  767 93.60% 1.30% 0.52% 4.56% NA
Tropical Japonica  504 85.50% 1.40% 1.98% 11.11% NA
Japonica Intermediate  241 56.00% 10.00% 2.49% 31.54% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 17.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906314868 G -> DEL N N silent_mutation Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg0906314868 G -> C LOC_Os09g11360.1 upstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg0906314868 G -> C LOC_Os09g11360-LOC_Os09g11370 intergenic_region ; MODIFIER silent_mutation Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg0906314868 G -> A LOC_Os09g11360.1 upstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N
vg0906314868 G -> A LOC_Os09g11360-LOC_Os09g11370 intergenic_region ; MODIFIER silent_mutation Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906314868 NA 7.56E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906314868 3.34E-06 NA mr1160_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906314868 8.23E-07 6.86E-08 mr1160_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251