\
| Variant ID: vg0906314868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6314868 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )
TCTGCCGTTGCTAATGGATGATTACGTCTTCTCCTCCGGTTGCTTCCGTCATTGCTGACTTGTTATTTCGCCCTCACGGTTGACCTACTTTGCAAACGCT[G/A,C]
ATGAGCGTCTTCGTCATTATCATCAGTTGCTACACTGCTATTGACTGGATCACCGACATCGTCATCTTCATCAATATCCTGTCAAGCCTCTTCAACATAG
CTATGTTGAAGAGGCTTGACAGGATATTGATGAAGATGACGATGTCGGTGATCCAGTCAATAGCAGTGTAGCAACTGATGATAATGACGAAGACGCTCAT[C/T,G]
AGCGTTTGCAAAGTAGGTCAACCGTGAGGGCGAAATAACAAGTCAGCAATGACGGAAGCAACCGGAGGAGAAGACGTAATCATCCATTAGCAACGGCAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 30.40% | 1.04% | 6.07% | C: 0.08% |
| All Indica | 2759 | 45.10% | 50.00% | 0.94% | 3.84% | C: 0.14% |
| All Japonica | 1512 | 84.90% | 2.70% | 1.32% | 11.04% | NA |
| Aus | 269 | 94.40% | 0.70% | 0.37% | 4.46% | NA |
| Indica I | 595 | 27.20% | 66.70% | 0.50% | 5.21% | C: 0.34% |
| Indica II | 465 | 69.20% | 30.10% | 0.43% | 0.22% | NA |
| Indica III | 913 | 38.10% | 57.20% | 0.88% | 3.61% | C: 0.22% |
| Indica Intermediate | 786 | 52.40% | 40.70% | 1.65% | 5.22% | NA |
| Temperate Japonica | 767 | 93.60% | 1.30% | 0.52% | 4.56% | NA |
| Tropical Japonica | 504 | 85.50% | 1.40% | 1.98% | 11.11% | NA |
| Japonica Intermediate | 241 | 56.00% | 10.00% | 2.49% | 31.54% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 17.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906314868 | G -> DEL | N | N | silent_mutation | Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0906314868 | G -> C | LOC_Os09g11360.1 | upstream_gene_variant ; 3735.0bp to feature; MODIFIER | silent_mutation | Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0906314868 | G -> C | LOC_Os09g11360-LOC_Os09g11370 | intergenic_region ; MODIFIER | silent_mutation | Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0906314868 | G -> A | LOC_Os09g11360.1 | upstream_gene_variant ; 3735.0bp to feature; MODIFIER | silent_mutation | Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0906314868 | G -> A | LOC_Os09g11360-LOC_Os09g11370 | intergenic_region ; MODIFIER | silent_mutation | Average:31.147; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906314868 | NA | 7.56E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906314868 | 3.34E-06 | NA | mr1160_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906314868 | 8.23E-07 | 6.86E-08 | mr1160_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |