\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906313471:

Variant ID: vg0906313471 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6313471
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTATCTCCGCCTGCACGGCTGGCCTATTATGCCGCCGTTGTTTTGGGCGTCTACGTCTTCACCGTCGGCTGCCTTCGCCGCCGCCAACTGGTATCTCC[A/G]
CCTGCACGGCTGGCCTATTATGCCGCCGTTGTTTGGCGTCTACGTCTTCACCGCCGGCTCACCTTGGCCGCCGTCAACTGGTGTCTCCGCCTGCACGGCT

Reverse complement sequence

AGCCGTGCAGGCGGAGACACCAGTTGACGGCGGCCAAGGTGAGCCGGCGGTGAAGACGTAGACGCCAAACAACGGCGGCATAATAGGCCAGCCGTGCAGG[T/C]
GGAGATACCAGTTGGCGGCGGCGAAGGCAGCCGACGGTGAAGACGTAGACGCCCAAAACAACGGCGGCATAATAGGCCAGCCGTGCAGGCGGAGATACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 41.10% 1.18% 7.49% NA
All Indica  2759 37.20% 56.40% 1.23% 5.22% NA
All Japonica  1512 83.50% 3.00% 0.86% 12.57% NA
Aus  269 4.80% 87.40% 1.86% 5.95% NA
Indica I  595 22.00% 70.60% 1.01% 6.39% NA
Indica II  465 61.50% 38.10% 0.22% 0.22% NA
Indica III  913 31.40% 62.50% 1.31% 4.71% NA
Indica Intermediate  786 40.80% 49.40% 1.91% 7.89% NA
Temperate Japonica  767 93.60% 0.90% 0.39% 5.08% NA
Tropical Japonica  504 85.30% 1.00% 0.60% 13.10% NA
Japonica Intermediate  241 47.70% 14.10% 2.90% 35.27% NA
VI/Aromatic  96 15.60% 81.20% 3.12% 0.00% NA
Intermediate  90 62.20% 32.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906313471 A -> G LOC_Os09g11360.1 upstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:61.236; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg0906313471 A -> G LOC_Os09g11360-LOC_Os09g11370 intergenic_region ; MODIFIER silent_mutation Average:61.236; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg0906313471 A -> DEL N N silent_mutation Average:61.236; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906313471 NA 5.70E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 9.68E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 4.68E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.69E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 2.00E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.46E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 7.57E-07 1.73E-09 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.79E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 4.94E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.18E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 8.13E-06 7.33E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 1.82E-06 1.35E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 2.10E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.88E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.44E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 2.49E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 1.45E-06 6.53E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 1.85E-06 2.92E-08 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 9.53E-07 9.45E-09 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 4.09E-07 3.19E-10 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 6.29E-07 9.73E-09 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 3.57E-08 5.50E-11 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 8.84E-09 1.75E-10 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 7.33E-08 1.45E-09 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 1.19E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 1.06E-07 6.85E-11 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 1.44E-06 2.20E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 1.79E-07 1.54E-09 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 6.18E-08 1.74E-08 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 2.31E-07 5.26E-11 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 9.84E-06 1.54E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906313471 NA 6.92E-07 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251