\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906308651:

Variant ID: vg0906308651 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6308651
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGACTTTCTCCTCATCATTGCACTGCACGGTATCCAACTTTTTCCCCACGGCATGCAACCAATCCAACGCATCAACGGGGTTATTGGAACTAGAGAAG[G/T]
TAGGCGGACAGATGCGGAGGAACTCGGCGAGTTTAGAGTGTTGTGGGGGTGGTGGTGGAGGTGGAGCATTATGCTGTGGCGGATTTTGGATGTGATGGAG

Reverse complement sequence

CTCCATCACATCCAAAATCCGCCACAGCATAATGCTCCACCTCCACCACCACCCCCACAACACTCTAAACTCGCCGAGTTCCTCCGCATCTGTCCGCCTA[C/A]
CTTCTCTAGTTCCAATAACCCCGTTGATGCGTTGGATTGGTTGCATGCCGTGGGGAAAAAGTTGGATACCGTGCAGTGCAATGATGAGGAGAAAGTCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 5.10% 5.37% 1.95% NA
All Indica  2759 90.70% 0.20% 6.05% 3.04% NA
All Japonica  1512 82.10% 14.90% 2.65% 0.40% NA
Aus  269 86.20% 0.00% 13.75% 0.00% NA
Indica I  595 83.70% 0.20% 9.08% 7.06% NA
Indica II  465 91.80% 0.00% 4.30% 3.87% NA
Indica III  913 93.40% 0.10% 6.13% 0.33% NA
Indica Intermediate  786 92.20% 0.40% 4.71% 2.67% NA
Temperate Japonica  767 95.30% 2.50% 1.69% 0.52% NA
Tropical Japonica  504 59.50% 36.90% 3.37% 0.20% NA
Japonica Intermediate  241 87.10% 8.30% 4.15% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 78.90% 11.10% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906308651 G -> DEL LOC_Os09g11360.1 N frameshift_variant Average:56.187; most accessible tissue: Minghui63 flag leaf, score: 93.091 N N N N
vg0906308651 G -> T LOC_Os09g11360.1 missense_variant ; p.Thr319Asn; MODERATE nonsynonymous_codon ; T319N Average:56.187; most accessible tissue: Minghui63 flag leaf, score: 93.091 possibly damaging 1.865 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0906308651 G T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906308651 NA 5.13E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.63E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 5.67E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 4.66E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 4.74E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 5.90E-14 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.27E-16 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 6.89E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.14E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 4.29E-06 NA mr1299_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 6.60E-20 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 7.21E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.44E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.40E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 6.70E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.59E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 2.75E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 9.09E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 9.81E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.07E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.58E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 6.33E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 8.72E-06 4.48E-07 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.83E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906308651 NA 1.81E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251