\
| Variant ID: vg0906306952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6306952 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATCACCGTGAATTCATACAGCCCATATCGCGTGGTGAATGCGGTCTTCGGGATATCTTCTTCACGAATACACAATTGGTGATATCTGGAACGAAGATC[G/A]
ATTTTAGAAAACACAGTGGCACCTTTAAGCTGATCGAACAGATCATCGATCTGGGGAAGAGGGTACTTGTTTTTGATAGTAACTTCATTAAGAGCTCTGT
ACAGAGCTCTTAATGAAGTTACTATCAAAAACAAGTACCCTCTTCCCCAGATCGATGATCTGTTCGATCAGCTTAAAGGTGCCACTGTGTTTTCTAAAAT[C/T]
GATCTTCGTTCCAGATATCACCAATTGTGTATTCGTGAAGAAGATATCCCGAAGACCGCATTCACCACGCGATATGGGCTGTATGAATTCACGGTGATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 4.60% | 2.84% | 21.75% | NA |
| All Indica | 2759 | 64.30% | 0.40% | 1.70% | 33.56% | NA |
| All Japonica | 1512 | 84.30% | 12.00% | 1.59% | 2.12% | NA |
| Aus | 269 | 69.50% | 0.40% | 16.73% | 13.38% | NA |
| Indica I | 595 | 51.10% | 0.20% | 2.18% | 46.55% | NA |
| Indica II | 465 | 66.50% | 0.00% | 1.72% | 31.83% | NA |
| Indica III | 913 | 72.40% | 0.50% | 1.64% | 25.41% | NA |
| Indica Intermediate | 786 | 63.70% | 0.60% | 1.40% | 34.22% | NA |
| Temperate Japonica | 767 | 95.40% | 2.50% | 1.17% | 0.91% | NA |
| Tropical Japonica | 504 | 68.30% | 28.40% | 2.18% | 1.19% | NA |
| Japonica Intermediate | 241 | 82.20% | 8.30% | 1.66% | 7.88% | NA |
| VI/Aromatic | 96 | 52.10% | 12.50% | 16.67% | 18.75% | NA |
| Intermediate | 90 | 67.80% | 12.20% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906306952 | G -> DEL | LOC_Os09g11360.1 | N | frameshift_variant | Average:30.334; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0906306952 | G -> A | LOC_Os09g11360.1 | synonymous_variant ; p.Ile798Ile; LOW | synonymous_codon | Average:30.334; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906306952 | NA | 5.39E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 1.69E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 1.19E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 9.08E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 7.52E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 5.35E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 1.38E-19 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 5.29E-16 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 1.53E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 2.65E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | 8.01E-07 | 9.21E-08 | mr1849_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 2.31E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | 5.82E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 2.38E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906306952 | NA | 2.56E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |