| Variant ID: vg0906300837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6300837 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.33, others allele: 0.00, population size: 80. )
CCGCCTACGCGGCTGGCCTATTATGCCGCCGTTGTTGGGCATCCTCGTCTTCACCGACCGGCTTTCCTTCGTCGCCGCCGACTGGTGTTTCCGCCTGCAC[T/G]
GCTGGCCTATTATATGCTGCCGTTGTTGGGCGTCCGTCGACTGGTGTCCTCACCTATACGGTTGGCTGGTCACACCACCGTACATGGGCATCCACGTCTT
AAGACGTGGATGCCCATGTACGGTGGTGTGACCAGCCAACCGTATAGGTGAGGACACCAGTCGACGGACGCCCAACAACGGCAGCATATAATAGGCCAGC[A/C]
GTGCAGGCGGAAACACCAGTCGGCGGCGACGAAGGAAAGCCGGTCGGTGAAGACGAGGATGCCCAACAACGGCGGCATAATAGGCCAGCCGCGTAGGCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.60% | 18.80% | 30.66% | 7.89% | NA |
| All Indica | 2759 | 16.20% | 31.10% | 44.94% | 7.68% | NA |
| All Japonica | 1512 | 98.10% | 0.50% | 1.32% | 0.13% | NA |
| Aus | 269 | 8.60% | 0.70% | 39.03% | 51.67% | NA |
| Indica I | 595 | 24.00% | 10.40% | 54.29% | 11.26% | NA |
| Indica II | 465 | 8.40% | 55.50% | 26.24% | 9.89% | NA |
| Indica III | 913 | 11.80% | 29.90% | 55.64% | 2.63% | NA |
| Indica Intermediate | 786 | 20.10% | 33.80% | 36.51% | 9.54% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 1.20% | 6.64% | 0.83% | NA |
| VI/Aromatic | 96 | 11.50% | 4.20% | 67.71% | 16.67% | NA |
| Intermediate | 90 | 55.60% | 18.90% | 21.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906300837 | T -> G | LOC_Os09g11350.1 | upstream_gene_variant ; 84.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0906300837 | T -> G | LOC_Os09g11330.1 | downstream_gene_variant ; 4885.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0906300837 | T -> G | LOC_Os09g11360.1 | downstream_gene_variant ; 4771.0bp to feature; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0906300837 | T -> G | LOC_Os09g11330-LOC_Os09g11350 | intergenic_region ; MODIFIER | silent_mutation | Average:48.501; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0906300837 | T -> DEL | N | N | silent_mutation | Average:48.501; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906300837 | 1.11E-06 | 8.28E-06 | mr1101 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | NA | 7.88E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | 9.57E-07 | 1.24E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | NA | 1.52E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | NA | 3.36E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | 3.50E-06 | 8.57E-07 | mr1495 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | 5.52E-07 | 1.36E-07 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | NA | 7.77E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906300837 | NA | 8.89E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/