Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906213033:

Variant ID: vg0906213033 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 6213033
Reference Allele: AG	Alternative Allele: A,GG
Primary Allele: AG	Secondary Allele: GG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCACAATGTAAGTCATTTTAGCATTTCCCACATTTATATTGATGTTAAAGAATCTAGACATATATATCTATATAGATTCATTAACATCAATATATATGT[AG/A,GG]
GAAATACTAAAATGACTTACATTATGAAACGGAGAAAGTAGCAGTTTAGCCGAGTTGTAGGATCAAAGTCAGCCGTGTAGAACCTTAGTTTAGCTAGCTA

Reverse complement sequence

TAGCTAGCTAAACTAAGGTTCTACACGGCTGACTTTGATCCTACAACTCGGCTAAACTGCTACTTTCTCCGTTTCATAATGTAAGTCATTTTAGTATTTC[CT/T,CC]
ACATATATATTGATGTTAATGAATCTATATAGATATATATGTCTAGATTCTTTAACATCAATATAAATGTGGGAAATGCTAAAATGACTTACATTGTGAA

Allele Frequencies:

Populations	Population Size	Frequency of AG(primary allele)	Frequency of GG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.20%	29.20%	5.67%	7.64%	A: 26.30%
All Indica	2759	8.30%	28.60%	7.50%	11.20%	A: 44.36%
All Japonica	1512	73.90%	25.70%	0.00%	0.13%	A: 0.26%
Aus	269	32.70%	48.00%	18.22%	1.12%	NA
Indica I	595	7.70%	25.00%	2.86%	1.18%	A: 63.19%
Indica II	465	1.70%	26.00%	19.35%	25.59%	A: 27.31%
Indica III	913	13.90%	26.50%	3.40%	10.19%	A: 46.00%
Indica Intermediate	786	6.20%	35.20%	8.78%	11.45%	A: 38.30%
Temperate Japonica	767	84.60%	15.10%	0.00%	0.13%	A: 0.13%
Tropical Japonica	504	73.60%	26.00%	0.00%	0.00%	A: 0.40%
Japonica Intermediate	241	40.70%	58.50%	0.00%	0.41%	A: 0.41%
VI/Aromatic	96	5.20%	53.10%	2.08%	39.58%	NA
Intermediate	90	35.60%	26.70%	11.11%	10.00%	A: 16.67%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906213033	AG -> DEL	N	N	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N
vg0906213033	AG -> A	LOC_Os09g11210.1	upstream_gene_variant ; 517.0bp to feature; MODIFIER	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N
vg0906213033	AG -> A	LOC_Os09g11200.1	downstream_gene_variant ; 3807.0bp to feature; MODIFIER	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N
vg0906213033	AG -> A	LOC_Os09g11210-LOC_Os09g11220	intergenic_region ; MODIFIER	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N
vg0906213033	AG -> GG	LOC_Os09g11210.1	upstream_gene_variant ; 516.0bp to feature; MODIFIER	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N
vg0906213033	AG -> GG	LOC_Os09g11200.1	downstream_gene_variant ; 3806.0bp to feature; MODIFIER	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N
vg0906213033	AG -> GG	LOC_Os09g11210-LOC_Os09g11220	intergenic_region ; MODIFIER	silent_mutation	Average:42.549; most accessible tissue: Callus, score: 69.139	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906213033	NA	3.19E-06	mr1137_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906213033	9.39E-08	6.87E-08	mr1160_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906213033	NA	6.07E-06	mr1617_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906213033	8.28E-06	NA	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251