\
| Variant ID: vg0906198689 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6198689 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 65. )
AATATTTTCGATCTACTTAGTGAAACAATTCCGATATACCTAGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAAAAAAAATTTCGTC[G/A]
GAATATATCAATGCGTGGTCTTGTTTTGAAGATTTAATTACAACGAATTTAATGATGCAATCGGATCATAATTTGAATCAGAATAAGTAATTTAAGAGAA
TTCTCTTAAATTACTTATTCTGATTCAAATTATGATCCGATTGCATCATTAAATTCGTTGTAATTAAATCTTCAAAACAAGACCACGCATTGATATATTC[C/T]
GACGAAATTTTTTTTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACTAGGTATATCGGAATTGTTTCACTAAGTAGATCGAAAATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.70% | 35.30% | 0.36% | 28.65% | NA |
| All Indica | 2759 | 14.60% | 55.50% | 0.33% | 29.61% | NA |
| All Japonica | 1512 | 77.70% | 0.60% | 0.33% | 21.36% | NA |
| Aus | 269 | 19.30% | 38.30% | 0.00% | 42.38% | NA |
| Indica I | 595 | 23.70% | 72.10% | 0.17% | 4.03% | NA |
| Indica II | 465 | 9.50% | 32.70% | 0.22% | 57.63% | NA |
| Indica III | 913 | 9.10% | 62.80% | 0.00% | 28.15% | NA |
| Indica Intermediate | 786 | 17.20% | 47.80% | 0.89% | 34.10% | NA |
| Temperate Japonica | 767 | 88.50% | 0.30% | 0.26% | 10.95% | NA |
| Tropical Japonica | 504 | 76.60% | 0.60% | 0.40% | 22.42% | NA |
| Japonica Intermediate | 241 | 45.60% | 1.70% | 0.41% | 52.28% | NA |
| VI/Aromatic | 96 | 11.50% | 6.20% | 1.04% | 81.25% | NA |
| Intermediate | 90 | 51.10% | 22.20% | 2.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906198689 | G -> DEL | N | N | silent_mutation | Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0906198689 | G -> A | LOC_Os09g11170.1 | downstream_gene_variant ; 1772.0bp to feature; MODIFIER | silent_mutation | Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0906198689 | G -> A | LOC_Os09g11180.1 | downstream_gene_variant ; 858.0bp to feature; MODIFIER | silent_mutation | Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0906198689 | G -> A | LOC_Os09g11180-LOC_Os09g11190 | intergenic_region ; MODIFIER | silent_mutation | Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906198689 | 1.49E-06 | 1.49E-06 | mr1321 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906198689 | NA | 5.45E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906198689 | NA | 3.66E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906198689 | NA | 2.39E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906198689 | NA | 3.37E-06 | mr1137_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906198689 | NA | 9.42E-06 | mr1348_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906198689 | NA | 8.11E-06 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |