\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906198689:

Variant ID: vg0906198689 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6198689
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTTTCGATCTACTTAGTGAAACAATTCCGATATACCTAGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAAAAAAAATTTCGTC[G/A]
GAATATATCAATGCGTGGTCTTGTTTTGAAGATTTAATTACAACGAATTTAATGATGCAATCGGATCATAATTTGAATCAGAATAAGTAATTTAAGAGAA

Reverse complement sequence

TTCTCTTAAATTACTTATTCTGATTCAAATTATGATCCGATTGCATCATTAAATTCGTTGTAATTAAATCTTCAAAACAAGACCACGCATTGATATATTC[C/T]
GACGAAATTTTTTTTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACTAGGTATATCGGAATTGTTTCACTAAGTAGATCGAAAATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 35.30% 0.36% 28.65% NA
All Indica  2759 14.60% 55.50% 0.33% 29.61% NA
All Japonica  1512 77.70% 0.60% 0.33% 21.36% NA
Aus  269 19.30% 38.30% 0.00% 42.38% NA
Indica I  595 23.70% 72.10% 0.17% 4.03% NA
Indica II  465 9.50% 32.70% 0.22% 57.63% NA
Indica III  913 9.10% 62.80% 0.00% 28.15% NA
Indica Intermediate  786 17.20% 47.80% 0.89% 34.10% NA
Temperate Japonica  767 88.50% 0.30% 0.26% 10.95% NA
Tropical Japonica  504 76.60% 0.60% 0.40% 22.42% NA
Japonica Intermediate  241 45.60% 1.70% 0.41% 52.28% NA
VI/Aromatic  96 11.50% 6.20% 1.04% 81.25% NA
Intermediate  90 51.10% 22.20% 2.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906198689 G -> DEL N N silent_mutation Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0906198689 G -> A LOC_Os09g11170.1 downstream_gene_variant ; 1772.0bp to feature; MODIFIER silent_mutation Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0906198689 G -> A LOC_Os09g11180.1 downstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0906198689 G -> A LOC_Os09g11180-LOC_Os09g11190 intergenic_region ; MODIFIER silent_mutation Average:18.775; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906198689 1.49E-06 1.49E-06 mr1321 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906198689 NA 5.45E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906198689 NA 3.66E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906198689 NA 2.39E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906198689 NA 3.37E-06 mr1137_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906198689 NA 9.42E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906198689 NA 8.11E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251