\
| Variant ID: vg0906115244 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6115244 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, A: 0.38, others allele: 0.00, population size: 90. )
CTTCGGAGTTGTGGGGCTATGGTTGTTGATGATCGATGATGGACAGGGAAGGGATTGGGGTCCTATTTATAGGGCTAGGAGGAGCGGATGAGCTCGGGCA[A/C]
CGTCATCGCCATGGATGAGCTCGAGCTTTGGATATGGTTAGGGCGGCAGAGGCTGTGAGAGGGCGGCCAAGATCAATTTGAGTGGCGGGAGGCCACGTTC
GAACGTGGCCTCCCGCCACTCAAATTGATCTTGGCCGCCCTCTCACAGCCTCTGCCGCCCTAACCATATCCAAAGCTCGAGCTCATCCATGGCGATGACG[T/G]
TGCCCGAGCTCATCCGCTCCTCCTAGCCCTATAAATAGGACCCCAATCCCTTCCCTGTCCATCATCGATCATCAACAACCATAGCCCCACAACTCCGAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 26.50% | 73.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.30% | 63.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906115244 | A -> C | LOC_Os09g11020.1 | downstream_gene_variant ; 1769.0bp to feature; MODIFIER | silent_mutation | Average:52.93; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 | N | N | N | N |
| vg0906115244 | A -> C | LOC_Os09g11010-LOC_Os09g11020 | intergenic_region ; MODIFIER | silent_mutation | Average:52.93; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906115244 | NA | 5.51E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | 8.57E-06 | 8.56E-06 | mr1286_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 2.07E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | 3.07E-06 | NA | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | 3.91E-06 | 3.90E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 7.40E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 4.12E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 3.61E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 4.08E-06 | mr1812_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 7.16E-06 | mr1816_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | 6.94E-06 | 6.94E-06 | mr1832_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906115244 | NA | 7.78E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |