\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906112264:

Variant ID: vg0906112264 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 6112264
Reference Allele: CCAAlternative Allele: GCA,C,TCA
Primary Allele: CCASecondary Allele: GCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGCAAGATCACTGGTAGAGAAACCCTTTTTACTCCCGTTTGGGAACCCCCTTTAGTCCTGGGTTTCCAACCGGGAGTAGCAATCCGAGACTAAAGATGC[CCA/GCA,C,TCA]
TCTTTAGTCCCGGTTGAAATAACCGGGACTAAAGATGGATCTTTAGTCAGATAGGATATCTTTAGTCCCGGTTGGTGTTACCAACCAGAACTAAAGAGGA

Reverse complement sequence

TCCTCTTTAGTTCTGGTTGGTAACACCAACCGGGACTAAAGATATCCTATCTGACTAAAGATCCATCTTTAGTCCCGGTTATTTCAACCGGGACTAAAGA[TGG/TGC,G,TGA]
GCATCTTTAGTCTCGGATTGCTACTCCCGGTTGGAAACCCAGGACTAAAGGGGGTTCCCAAACGGGAGTAAAAAGGGTTTCTCTACCAGTGATCTTGCCT

Allele Frequencies:

Populations Population SizeFrequency of CCA(primary allele) Frequency of GCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 10.90% 0.13% 1.08% TCA: 0.04%
All Indica  2759 92.60% 5.30% 0.22% 1.78% TCA: 0.07%
All Japonica  1512 76.70% 23.30% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 84.90% 11.40% 0.34% 3.36% NA
Indica II  465 99.10% 0.20% 0.00% 0.65% NA
Indica III  913 94.10% 3.50% 0.11% 2.19% TCA: 0.11%
Indica Intermediate  786 92.90% 5.90% 0.38% 0.76% TCA: 0.13%
Temperate Japonica  767 89.60% 10.40% 0.00% 0.00% NA
Tropical Japonica  504 66.30% 33.70% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 42.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906112264 CCA -> GCA LOC_Os09g11020.1 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0906112264 CCA -> GCA LOC_Os09g11010-LOC_Os09g11020 intergenic_region ; MODIFIER silent_mutation Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0906112264 CCA -> DEL N N silent_mutation Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0906112264 CCA -> C LOC_Os09g11020.1 downstream_gene_variant ; 4748.0bp to feature; MODIFIER N Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0906112264 CCA -> C LOC_Os09g11010-LOC_Os09g11020 intergenic_region ; MODIFIER N Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0906112264 CCA -> TCA LOC_Os09g11020.1 downstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0906112264 CCA -> TCA LOC_Os09g11010-LOC_Os09g11020 intergenic_region ; MODIFIER silent_mutation Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906112264 NA 8.48E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112264 4.99E-07 7.77E-08 mr1312_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112264 NA 7.74E-07 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112264 NA 1.99E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112264 NA 6.86E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251