\
| Variant ID: vg0906112264 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 6112264 |
| Reference Allele: CCA | Alternative Allele: GCA,C,TCA |
| Primary Allele: CCA | Secondary Allele: GCA |
Inferred Ancestral Allele: Not determined.
AGGCAAGATCACTGGTAGAGAAACCCTTTTTACTCCCGTTTGGGAACCCCCTTTAGTCCTGGGTTTCCAACCGGGAGTAGCAATCCGAGACTAAAGATGC[CCA/GCA,C,TCA]
TCTTTAGTCCCGGTTGAAATAACCGGGACTAAAGATGGATCTTTAGTCAGATAGGATATCTTTAGTCCCGGTTGGTGTTACCAACCAGAACTAAAGAGGA
TCCTCTTTAGTTCTGGTTGGTAACACCAACCGGGACTAAAGATATCCTATCTGACTAAAGATCCATCTTTAGTCCCGGTTATTTCAACCGGGACTAAAGA[TGG/TGC,G,TGA]
GCATCTTTAGTCTCGGATTGCTACTCCCGGTTGGAAACCCAGGACTAAAGGGGGTTCCCAAACGGGAGTAAAAAGGGTTTCTCTACCAGTGATCTTGCCT
| Populations | Population Size | Frequency of CCA(primary allele) | Frequency of GCA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 10.90% | 0.13% | 1.08% | TCA: 0.04% |
| All Indica | 2759 | 92.60% | 5.30% | 0.22% | 1.78% | TCA: 0.07% |
| All Japonica | 1512 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 84.90% | 11.40% | 0.34% | 3.36% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 94.10% | 3.50% | 0.11% | 2.19% | TCA: 0.11% |
| Indica Intermediate | 786 | 92.90% | 5.90% | 0.38% | 0.76% | TCA: 0.13% |
| Temperate Japonica | 767 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 66.30% | 33.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906112264 | CCA -> GCA | LOC_Os09g11020.1 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0906112264 | CCA -> GCA | LOC_Os09g11010-LOC_Os09g11020 | intergenic_region ; MODIFIER | silent_mutation | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0906112264 | CCA -> DEL | N | N | silent_mutation | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0906112264 | CCA -> C | LOC_Os09g11020.1 | downstream_gene_variant ; 4748.0bp to feature; MODIFIER | N | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0906112264 | CCA -> C | LOC_Os09g11010-LOC_Os09g11020 | intergenic_region ; MODIFIER | N | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0906112264 | CCA -> TCA | LOC_Os09g11020.1 | downstream_gene_variant ; 4749.0bp to feature; MODIFIER | silent_mutation | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0906112264 | CCA -> TCA | LOC_Os09g11010-LOC_Os09g11020 | intergenic_region ; MODIFIER | silent_mutation | Average:52.417; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906112264 | NA | 8.48E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112264 | 4.99E-07 | 7.77E-08 | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112264 | NA | 7.74E-07 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112264 | NA | 1.99E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112264 | NA | 6.86E-07 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |