\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906112024:

Variant ID: vg0906112024 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6112024
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGATGGGCGACGACGGCGACGGACTGGATGCGCGATGGCGGCGGCAGCCTCGATGCGTGACCTCCCTGGCCGGCACGGACGACGAAGAGAGGAGACTTT[A/G]
TTTTTGTTAGTCCGATCATACTCCTGCTAAATCAACGGTTAGATTAGATTGGTACCTCATAGTACCTCGTAACTCATGGTACTTCCTCAAAGATGGGAAA

Reverse complement sequence

TTTCCCATCTTTGAGGAAGTACCATGAGTTACGAGGTACTATGAGGTACCAATCTAATCTAACCGTTGATTTAGCAGGAGTATGATCGGACTAACAAAAA[T/C]
AAAGTCTCCTCTCTTCGTCGTCCGTGCCGGCCAGGGAGGTCACGCATCGAGGCTGCCGCCGCCATCGCGCATCCAGTCCGTCGCCGTCGTCGCCCATCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 5.20% 0.04% 1.04% NA
All Indica  2759 93.10% 5.10% 0.07% 1.70% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 63.60% 36.10% 0.00% 0.37% NA
Indica I  595 95.50% 1.00% 0.34% 3.19% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 87.00% 10.70% 0.00% 2.30% NA
Indica Intermediate  786 95.00% 4.50% 0.00% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906112024 A -> G LOC_Os09g11020.1 downstream_gene_variant ; 4989.0bp to feature; MODIFIER silent_mutation Average:68.45; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0906112024 A -> G LOC_Os09g11010-LOC_Os09g11020 intergenic_region ; MODIFIER silent_mutation Average:68.45; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0906112024 A -> DEL N N silent_mutation Average:68.45; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906112024 NA 4.02E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112024 NA 1.91E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112024 8.98E-07 NA mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112024 NA 2.38E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906112024 NA 5.68E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251