\
| Variant ID: vg0906112024 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6112024 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCGATGGGCGACGACGGCGACGGACTGGATGCGCGATGGCGGCGGCAGCCTCGATGCGTGACCTCCCTGGCCGGCACGGACGACGAAGAGAGGAGACTTT[A/G]
TTTTTGTTAGTCCGATCATACTCCTGCTAAATCAACGGTTAGATTAGATTGGTACCTCATAGTACCTCGTAACTCATGGTACTTCCTCAAAGATGGGAAA
TTTCCCATCTTTGAGGAAGTACCATGAGTTACGAGGTACTATGAGGTACCAATCTAATCTAACCGTTGATTTAGCAGGAGTATGATCGGACTAACAAAAA[T/C]
AAAGTCTCCTCTCTTCGTCGTCCGTGCCGGCCAGGGAGGTCACGCATCGAGGCTGCCGCCGCCATCGCGCATCCAGTCCGTCGCCGTCGTCGCCCATCGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 5.20% | 0.04% | 1.04% | NA |
| All Indica | 2759 | 93.10% | 5.10% | 0.07% | 1.70% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 63.60% | 36.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 95.50% | 1.00% | 0.34% | 3.19% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.00% | 0.65% | NA |
| Indica III | 913 | 87.00% | 10.70% | 0.00% | 2.30% | NA |
| Indica Intermediate | 786 | 95.00% | 4.50% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906112024 | A -> G | LOC_Os09g11020.1 | downstream_gene_variant ; 4989.0bp to feature; MODIFIER | silent_mutation | Average:68.45; most accessible tissue: Zhenshan97 panicle, score: 86.432 | N | N | N | N |
| vg0906112024 | A -> G | LOC_Os09g11010-LOC_Os09g11020 | intergenic_region ; MODIFIER | silent_mutation | Average:68.45; most accessible tissue: Zhenshan97 panicle, score: 86.432 | N | N | N | N |
| vg0906112024 | A -> DEL | N | N | silent_mutation | Average:68.45; most accessible tissue: Zhenshan97 panicle, score: 86.432 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906112024 | NA | 4.02E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112024 | NA | 1.91E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112024 | 8.98E-07 | NA | mr1013 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112024 | NA | 2.38E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906112024 | NA | 5.68E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |