\
| Variant ID: vg0905970596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5970596 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )
CGATGAACTGTGGCATGTTAGGCCTAATATGTTGTATCAAGTAGCTACTACAAAAAGAAACCAGGCACCATTGGAAGAGGGATCGATGAATTGATGGACT[A/G]
GCCACGGCTCTTCTTCCTCCTCCATCTTCTCCCCAACCTAATGCTTCAATTGTAAAATCAAAGTGTTTTTGATTGTTATTCTGTGATGAACAATTGGTAT
ATACCAATTGTTCATCACAGAATAACAATCAAAAACACTTTGATTTTACAATTGAAGCATTAGGTTGGGGAGAAGATGGAGGAGGAAGAAGAGCCGTGGC[T/C]
AGTCCATCAATTCATCGATCCCTCTTCCAATGGTGCCTGGTTTCTTTTTGTAGTAGCTACTTGATACAACATATTAGGCCTAACATGCCACAGTTCATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 6.60% | 3.51% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 69.80% | 19.70% | 10.52% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 47.30% | 34.70% | 17.99% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 0.40% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 12.40% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905970596 | A -> G | LOC_Os09g10890.1 | upstream_gene_variant ; 1380.0bp to feature; MODIFIER | silent_mutation | Average:46.055; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg0905970596 | A -> G | LOC_Os09g10880.1 | downstream_gene_variant ; 4385.0bp to feature; MODIFIER | silent_mutation | Average:46.055; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg0905970596 | A -> G | LOC_Os09g10880-LOC_Os09g10890 | intergenic_region ; MODIFIER | silent_mutation | Average:46.055; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905970596 | NA | 5.96E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 2.08E-07 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 7.95E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 7.09E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 9.16E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 2.64E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 1.11E-06 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 6.01E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 9.40E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | 5.55E-06 | 1.76E-08 | mr1596_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 4.10E-07 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 1.86E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 3.88E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 1.85E-10 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905970596 | NA | 2.93E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |