\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905970596:

Variant ID: vg0905970596 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5970596
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CGATGAACTGTGGCATGTTAGGCCTAATATGTTGTATCAAGTAGCTACTACAAAAAGAAACCAGGCACCATTGGAAGAGGGATCGATGAATTGATGGACT[A/G]
GCCACGGCTCTTCTTCCTCCTCCATCTTCTCCCCAACCTAATGCTTCAATTGTAAAATCAAAGTGTTTTTGATTGTTATTCTGTGATGAACAATTGGTAT

Reverse complement sequence

ATACCAATTGTTCATCACAGAATAACAATCAAAAACACTTTGATTTTACAATTGAAGCATTAGGTTGGGGAGAAGATGGAGGAGGAAGAAGAGCCGTGGC[T/C]
AGTCCATCAATTCATCGATCCCTCTTCCAATGGTGCCTGGTTTCTTTTTGTAGTAGCTACTTGATACAACATATTAGGCCTAACATGCCACAGTTCATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 6.60% 3.51% 0.00% NA
All Indica  2759 99.60% 0.30% 0.07% 0.00% NA
All Japonica  1512 69.80% 19.70% 10.52% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 47.30% 34.70% 17.99% 0.00% NA
Tropical Japonica  504 96.40% 0.40% 3.17% 0.00% NA
Japonica Intermediate  241 85.50% 12.40% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 7.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905970596 A -> G LOC_Os09g10890.1 upstream_gene_variant ; 1380.0bp to feature; MODIFIER silent_mutation Average:46.055; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg0905970596 A -> G LOC_Os09g10880.1 downstream_gene_variant ; 4385.0bp to feature; MODIFIER silent_mutation Average:46.055; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg0905970596 A -> G LOC_Os09g10880-LOC_Os09g10890 intergenic_region ; MODIFIER silent_mutation Average:46.055; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905970596 NA 5.96E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 2.08E-07 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 7.95E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 7.09E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 9.16E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 2.64E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 1.11E-06 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 6.01E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 9.40E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 5.55E-06 1.76E-08 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 4.10E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 1.86E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 3.88E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 1.85E-10 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905970596 NA 2.93E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251