\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905947134:

Variant ID: vg0905947134 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5947134
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGGCGTCGGATATTTCATTATGCTTGTTTGATGACTTGAATTATTCACTTCATCTCTCAAATATAGTGTTAATCTCTCAAATATAGTGGAAGGTCCGG[A/G]
GAGCCTATGATTGGACTTTTTCGGAAAATTTCAAATTTAGAATATTTGGAATTTTAAGAGGATTTAGGCAAATAAGAATTGAATAGGAACATTTTGGATT

Reverse complement sequence

AATCCAAAATGTTCCTATTCAATTCTTATTTGCCTAAATCCTCTTAAAATTCCAAATATTCTAAATTTGAAATTTTCCGAAAAAGTCCAATCATAGGCTC[T/C]
CCGGACCTTCCACTATATTTGAGAGATTAACACTATATTTGAGAGATGAAGTGAATAATTCAAGTCATCAAACAAGCATAATGAAATATCCGACGCCTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 10.80% 0.28% 5.44% NA
All Indica  2759 81.20% 18.00% 0.29% 0.51% NA
All Japonica  1512 83.40% 0.30% 0.33% 15.94% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 52.90% 46.70% 0.34% 0.00% NA
Indica II  465 91.20% 8.40% 0.43% 0.00% NA
Indica III  913 93.60% 5.70% 0.33% 0.33% NA
Indica Intermediate  786 82.30% 16.20% 0.13% 1.40% NA
Temperate Japonica  767 91.00% 0.00% 0.13% 8.87% NA
Tropical Japonica  504 84.50% 1.00% 0.40% 14.09% NA
Japonica Intermediate  241 56.80% 0.00% 0.83% 42.32% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905947134 A -> G LOC_Os09g10860.1 upstream_gene_variant ; 3287.0bp to feature; MODIFIER silent_mutation Average:32.801; most accessible tissue: Callus, score: 39.971 N N N N
vg0905947134 A -> G LOC_Os09g10865.1 upstream_gene_variant ; 3828.0bp to feature; MODIFIER silent_mutation Average:32.801; most accessible tissue: Callus, score: 39.971 N N N N
vg0905947134 A -> G LOC_Os09g10860-LOC_Os09g10865 intergenic_region ; MODIFIER silent_mutation Average:32.801; most accessible tissue: Callus, score: 39.971 N N N N
vg0905947134 A -> DEL N N silent_mutation Average:32.801; most accessible tissue: Callus, score: 39.971 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905947134 NA 8.44E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905947134 4.07E-06 NA mr1620 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251