\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905825342:

Variant ID: vg0905825342 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5825342
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGCTTCTATGTTGATTGTGTTGGGTGTTGATCCTGTGTTGGGTGTTGATTGTCTTGTCCCCCCTTTCCTCCTAAGGGGCCCTGTATTTATTCCCATAGG[T/C]
GTCCCCTTGTTCAAGTAGAACTAGAGAAACCAATATGGATACAATCCGAGTAGTCCTTGTCGTTTTTATTTTTAGAACTCTGGTTGTCTTTCTTTATCCG

Reverse complement sequence

CGGATAAAGAAAGACAACCAGAGTTCTAAAAATAAAAACGACAAGGACTACTCGGATTGTATCCATATTGGTTTCTCTAGTTCTACTTGAACAAGGGGAC[A/G]
CCTATGGGAATAAATACAGGGCCCCTTAGGAGGAAAGGGGGGACAAGACAATCAACACCCAACACAGGATCAACACCCAACACAATCAACATAGAAGCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.90% 0.00% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 74.10% 25.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 31.30% 68.70% 0.00% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905825342 T -> C LOC_Os09g10670.1 upstream_gene_variant ; 4360.0bp to feature; MODIFIER silent_mutation Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0905825342 T -> C LOC_Os09g10680.1 upstream_gene_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0905825342 T -> C LOC_Os09g10690.1 upstream_gene_variant ; 853.0bp to feature; MODIFIER silent_mutation Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0905825342 T -> C LOC_Os09g10700.1 downstream_gene_variant ; 4054.0bp to feature; MODIFIER silent_mutation Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0905825342 T -> C LOC_Os09g10680-LOC_Os09g10690 intergenic_region ; MODIFIER silent_mutation Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905825342 NA 7.96E-13 mr1089 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 2.06E-12 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 7.46E-10 mr1129 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 1.80E-12 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 5.26E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 3.37E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 1.09E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 4.68E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 5.09E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 6.72E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 4.20E-07 1.39E-18 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 7.09E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 6.00E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 1.88E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 1.95E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 3.60E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 5.55E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 5.27E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 6.78E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 2.05E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 8.66E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 2.28E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 6.04E-11 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 5.14E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 2.61E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 5.04E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 9.88E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 2.82E-07 5.21E-19 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 1.60E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 6.09E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 3.43E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 1.78E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905825342 NA 3.39E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251