| Variant ID: vg0905825342 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5825342 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGCTTCTATGTTGATTGTGTTGGGTGTTGATCCTGTGTTGGGTGTTGATTGTCTTGTCCCCCCTTTCCTCCTAAGGGGCCCTGTATTTATTCCCATAGG[T/C]
GTCCCCTTGTTCAAGTAGAACTAGAGAAACCAATATGGATACAATCCGAGTAGTCCTTGTCGTTTTTATTTTTAGAACTCTGGTTGTCTTTCTTTATCCG
CGGATAAAGAAAGACAACCAGAGTTCTAAAAATAAAAACGACAAGGACTACTCGGATTGTATCCATATTGGTTTCTCTAGTTCTACTTGAACAAGGGGAC[A/G]
CCTATGGGAATAAATACAGGGCCCCTTAGGAGGAAAGGGGGGACAAGACAATCAACACCCAACACAGGATCAACACCCAACACAATCAACATAGAAGCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.10% | 25.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.30% | 68.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905825342 | T -> C | LOC_Os09g10670.1 | upstream_gene_variant ; 4360.0bp to feature; MODIFIER | silent_mutation | Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 | N | N | N | N |
| vg0905825342 | T -> C | LOC_Os09g10680.1 | upstream_gene_variant ; 571.0bp to feature; MODIFIER | silent_mutation | Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 | N | N | N | N |
| vg0905825342 | T -> C | LOC_Os09g10690.1 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 | N | N | N | N |
| vg0905825342 | T -> C | LOC_Os09g10700.1 | downstream_gene_variant ; 4054.0bp to feature; MODIFIER | silent_mutation | Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 | N | N | N | N |
| vg0905825342 | T -> C | LOC_Os09g10680-LOC_Os09g10690 | intergenic_region ; MODIFIER | silent_mutation | Average:55.038; most accessible tissue: Minghui63 young leaf, score: 73.49 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905825342 | NA | 7.96E-13 | mr1089 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 2.06E-12 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 7.46E-10 | mr1129 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 1.80E-12 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 5.26E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 3.37E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 1.09E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 4.68E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 5.09E-21 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905825342 | NA | 6.72E-08 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/