\
| Variant ID: vg0905696575 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5696575 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCTGAGAGGATGTGGAGGGGATGTCCCGAGGCACAGACCCGCGCTTGGGCAAGCGCAAGGAAAGAGCGGTATGTGGCTCCTCGCACACAAACCGAAGGT[G/A]
AGTGACATGTTCAATCATCCGCATTATATGAGGAGCATAGGGAAGCCCTCGCTTATACTGAAGAGAAGCCATGCGGATTTCCTGCCAAACAAATAAAAAG
CTTTTTATTTGTTTGGCAGGAAATCCGCATGGCTTCTCTTCAGTATAAGCGAGGGCTTCCCTATGCTCCTCATATAATGCGGATGATTGAACATGTCACT[C/T]
ACCTTCGGTTTGTGTGCGAGGAGCCACATACCGCTCTTTCCTTGCGCTTGCCCAAGCGCGGGTCTGTGCCTCGGGACATCCCCTCCACATCCTCTCAGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 5.10% | 2.05% | 6.31% | NA |
| All Indica | 2759 | 98.50% | 0.10% | 1.34% | 0.11% | NA |
| All Japonica | 1512 | 66.40% | 15.30% | 2.91% | 15.41% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 97.60% | 0.20% | 2.02% | 0.17% | NA |
| Indica II | 465 | 98.30% | 0.20% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.00% | 0.77% | 0.11% | NA |
| Indica Intermediate | 786 | 98.50% | 0.00% | 1.40% | 0.13% | NA |
| Temperate Japonica | 767 | 92.20% | 0.30% | 1.17% | 6.39% | NA |
| Tropical Japonica | 504 | 35.30% | 43.70% | 5.95% | 15.08% | NA |
| Japonica Intermediate | 241 | 49.40% | 3.70% | 2.07% | 44.81% | NA |
| VI/Aromatic | 96 | 32.30% | 0.00% | 4.17% | 63.54% | NA |
| Intermediate | 90 | 81.10% | 7.80% | 10.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905696575 | G -> DEL | LOC_Os09g10420.1 | N | frameshift_variant | Average:57.298; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0905696575 | G -> A | LOC_Os09g10420.1 | missense_variant ; p.His241Tyr; MODERATE | nonsynonymous_codon ; H241Y | Average:57.298; most accessible tissue: Minghui63 young leaf, score: 71.254 | unknown | unknown | DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905696575 | NA | 5.26E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | NA | 8.35E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | NA | 6.57E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | 1.04E-06 | 1.04E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | 4.94E-06 | 1.25E-08 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | 2.98E-06 | 8.75E-09 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | NA | 6.94E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | 1.06E-06 | 1.02E-07 | mr1408_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | NA | 7.40E-08 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905696575 | NA | 6.24E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |