Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905694212:

Variant ID: vg0905694212 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5694212
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTCGGAAGTTCCAAAAATTTTCGGAATTATTTTCGGAAGTTCCGAAAATTCCTGGCCGAGCCCTCCAACCTTGGTTTCGAATGATTCTTGCCTCCAAT[C/G]
ACTTGTACATCTTCTCTTTGGCTTCTGAAAAGGTCAATTAGGCCTAGAGGGGGGGGGTGAATAGGCTAATTTAAAAACTTAAGGAAAGCGGAAGCAGTAA

Reverse complement sequence

TTACTGCTTCCGCTTTCCTTAAGTTTTTAAATTAGCCTATTCACCCCCCCCCTCTAGGCCTAATTGACCTTTTCAGAAGCCAAAGAGAAGATGTACAAGT[G/C]
ATTGGAGGCAAGAATCATTCGAAACCAAGGTTGGAGGGCTCGGCCAGGAATTTTCGGAACTTCCGAAAATAATTCCGAAAATTTTTGGAACTTCCGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	41.50%	0.42%	8.48%	NA
All Indica	2759	80.20%	17.40%	0.65%	1.67%	NA
All Japonica	1512	1.30%	81.90%	0.00%	16.87%	NA
Aus	269	29.00%	67.70%	0.37%	2.97%	NA
Indica I	595	76.80%	21.50%	1.34%	0.34%	NA
Indica II	465	65.20%	32.30%	1.08%	1.51%	NA
Indica III	913	88.00%	9.40%	0.00%	2.63%	NA
Indica Intermediate	786	82.80%	14.90%	0.64%	1.65%	NA
Temperate Japonica	767	1.40%	91.30%	0.00%	7.30%	NA
Tropical Japonica	504	0.20%	82.50%	0.00%	17.26%	NA
Japonica Intermediate	241	2.90%	50.60%	0.00%	46.47%	NA
VI/Aromatic	96	8.30%	10.40%	0.00%	81.25%	NA
Intermediate	90	28.90%	54.40%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905694212	C -> G	LOC_Os09g10430.1	upstream_gene_variant ; 3525.0bp to feature; MODIFIER	silent_mutation	Average:18.64; most accessible tissue: Callus, score: 37.11	N	N	N	N
vg0905694212	C -> G	LOC_Os09g10410.1	downstream_gene_variant ; 1594.0bp to feature; MODIFIER	silent_mutation	Average:18.64; most accessible tissue: Callus, score: 37.11	N	N	N	N
vg0905694212	C -> G	LOC_Os09g10420.1	downstream_gene_variant ; 1896.0bp to feature; MODIFIER	silent_mutation	Average:18.64; most accessible tissue: Callus, score: 37.11	N	N	N	N
vg0905694212	C -> G	LOC_Os09g10410-LOC_Os09g10420	intergenic_region ; MODIFIER	silent_mutation	Average:18.64; most accessible tissue: Callus, score: 37.11	N	N	N	N
vg0905694212	C -> DEL	N	N	silent_mutation	Average:18.64; most accessible tissue: Callus, score: 37.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905694212	NA	2.73E-06	mr1113	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905694212	NA	8.56E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905694212	NA	8.38E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905694212	NA	3.51E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251