Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905688587:

Variant ID: vg0905688587 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5688587
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.30, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATAGATTGTTATAGATTATTTTTAGTAAACTCTATAAGGGATTAATTCGCGGTAGTGATCTAGATGTAATTAAGGACTAGATAATTAGATAAAGTCT[T/A]
AGGGTATGACTTTAAATCACAAAATTTCTTAAGAAACACAAAAATTTTAGGTAGAGGAATAATTCCACTTCGCGAATAATATACTTGATGTAGAGTTCGT

Reverse complement sequence

ACGAACTCTACATCAAGTATATTATTCGCGAAGTGGAATTATTCCTCTACCTAAAATTTTTGTGTTTCTTAAGAAATTTTGTGATTTAAAGTCATACCCT[A/T]
AGACTTTATCTAATTATCTAGTCCTTAATTACATCTAGATCACTACCGCGAATTAATCCCTTATAGAGTTTACTAAAAATAATCTATAACAATCTATAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	20.90%	1.10%	46.61%	NA
All Indica	2759	7.90%	22.90%	1.59%	67.56%	NA
All Japonica	1512	79.00%	4.80%	0.20%	16.01%	NA
Aus	269	10.00%	85.90%	1.12%	2.97%	NA
Indica I	595	17.30%	3.70%	2.18%	76.81%	NA
Indica II	465	8.00%	21.30%	2.15%	68.60%	NA
Indica III	913	2.30%	35.90%	1.10%	60.68%	NA
Indica Intermediate	786	7.30%	23.40%	1.40%	67.94%	NA
Temperate Japonica	767	90.40%	0.40%	0.13%	9.13%	NA
Tropical Japonica	504	76.40%	10.70%	0.00%	12.90%	NA
Japonica Intermediate	241	48.50%	6.20%	0.83%	44.40%	NA
VI/Aromatic	96	4.20%	40.60%	1.04%	54.17%	NA
Intermediate	90	43.30%	14.40%	1.11%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905688587	T -> DEL	N	N	silent_mutation	Average:15.742; most accessible tissue: Callus, score: 34.723	N	N	N	N
vg0905688587	T -> A	LOC_Os09g10400.1	upstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:15.742; most accessible tissue: Callus, score: 34.723	N	N	N	N
vg0905688587	T -> A	LOC_Os09g10410.1	upstream_gene_variant ; 2208.0bp to feature; MODIFIER	silent_mutation	Average:15.742; most accessible tissue: Callus, score: 34.723	N	N	N	N
vg0905688587	T -> A	LOC_Os09g10390.1	downstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:15.742; most accessible tissue: Callus, score: 34.723	N	N	N	N
vg0905688587	T -> A	LOC_Os09g10400-LOC_Os09g10410	intergenic_region ; MODIFIER	silent_mutation	Average:15.742; most accessible tissue: Callus, score: 34.723	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905688587	NA	8.73E-06	mr1106	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	1.66E-06	1.66E-06	mr1205	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	NA	7.77E-06	mr1314	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	1.83E-06	1.83E-06	mr1370	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	NA	2.07E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	NA	2.78E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	NA	5.92E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905688587	5.98E-06	5.98E-06	mr1840	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251