\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905577010:

Variant ID: vg0905577010 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5577010
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACCGACAGGGCGGCGCTCACGGCCGGTCCGACCGGGCCTGACGGCCGGTCTGACCGCGACACAGCCGTCGGTCCGACCGGCCAGATGGCCGGTCGGACC[G/A]
GGTATTATCCCGTCGGTCCGACCGGCCAGATGGCCGGTCAGACCGGGTATTATCCCACTGGTCAGACCGGCTCTCAGGCAGGTCCGACCGCGCAATATGA

Reverse complement sequence

TCATATTGCGCGGTCGGACCTGCCTGAGAGCCGGTCTGACCAGTGGGATAATACCCGGTCTGACCGGCCATCTGGCCGGTCGGACCGACGGGATAATACC[C/T]
GGTCCGACCGGCCATCTGGCCGGTCGGACCGACGGCTGTGTCGCGGTCAGACCGGCCGTCAGGCCCGGTCGGACCGGCCGTGAGCGCCGCCCTGTCGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.10% 1.57% 0.00% NA
All Indica  2759 97.50% 1.50% 0.94% 0.00% NA
All Japonica  1512 96.50% 0.40% 3.11% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 97.80% 1.30% 0.86% 0.00% NA
Indica III  913 95.30% 3.20% 1.53% 0.00% NA
Indica Intermediate  786 98.20% 0.90% 0.89% 0.00% NA
Temperate Japonica  767 97.80% 0.00% 2.22% 0.00% NA
Tropical Japonica  504 96.60% 1.00% 2.38% 0.00% NA
Japonica Intermediate  241 92.10% 0.40% 7.47% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905577010 G -> A LOC_Os09g10240.1 missense_variant ; p.Gly147Arg; MODERATE nonsynonymous_codon ; G147R Average:76.89; most accessible tissue: Minghui63 young leaf, score: 91.572 probably damaging 2.607 TOLERATED 0.06

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0905577010 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905577010 NA 1.44E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 3.16E-06 1.64E-08 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 8.77E-07 2.94E-09 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 8.92E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 2.18E-06 1.44E-07 mr1183 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 5.28E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 9.69E-06 7.65E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 9.89E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 6.44E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 2.95E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 4.43E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 9.53E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 5.76E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905577010 NA 9.11E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251