\
| Variant ID: vg0905464468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5464468 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 96. )
TTTCAACAAGTTTGCGCCGCTTTCGAGCCACTAAGTGATGTAGATGGTGAAAGTGGAGATGATGATAAGGGAAAGAACGTCTCCGATGTGTGCTTCATGG[T/C]
GCGTGGTGAATCTGACACAGAGTATGAAGATAATGAGGTGTGTGCTTTTGAAGAAGCTATTAATATTTTGAGTGCAAAAAATAAAAAGTGTGAGAAGATA
TATCTTCTCACACTTTTTATTTTTTGCACTCAAAATATTAATAGCTTCTTCAAAAGCACACACCTCATTATCTTCATACTCTGTGTCAGATTCACCACGC[A/G]
CCATGAAGCACACATCGGAGACGTTCTTTCCCTTATCATCATCTCCACTTTCACCATCTACATCACTTAGTGGCTCGAAAGCGGCGCAAACTTGTTGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 30.10% | 5.84% | 8.97% | NA |
| All Indica | 2759 | 90.00% | 3.00% | 4.24% | 2.72% | NA |
| All Japonica | 1512 | 1.10% | 80.70% | 1.72% | 16.47% | NA |
| Aus | 269 | 19.00% | 24.20% | 22.68% | 34.20% | NA |
| Indica I | 595 | 92.60% | 2.50% | 1.34% | 3.53% | NA |
| Indica II | 465 | 92.90% | 0.90% | 3.66% | 2.58% | NA |
| Indica III | 913 | 91.90% | 3.50% | 4.05% | 0.55% | NA |
| Indica Intermediate | 786 | 84.10% | 4.20% | 7.00% | 4.71% | NA |
| Temperate Japonica | 767 | 0.90% | 89.60% | 0.39% | 9.13% | NA |
| Tropical Japonica | 504 | 1.00% | 81.90% | 2.98% | 14.09% | NA |
| Japonica Intermediate | 241 | 2.10% | 49.80% | 3.32% | 44.81% | NA |
| VI/Aromatic | 96 | 12.50% | 17.70% | 64.58% | 5.21% | NA |
| Intermediate | 90 | 43.30% | 42.20% | 11.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905464468 | T -> DEL | LOC_Os09g10030.1 | N | frameshift_variant | Average:22.333; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0905464468 | T -> C | LOC_Os09g10030.1 | missense_variant ; p.Val366Ala; MODERATE | nonsynonymous_codon ; V366A | Average:22.333; most accessible tissue: Minghui63 panicle, score: 29.741 | benign |
-0.382 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905464468 | NA | 5.11E-22 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 2.63E-21 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 1.93E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 5.00E-16 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 5.43E-12 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 3.44E-14 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 3.12E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 8.95E-22 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 8.86E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 2.87E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 4.95E-15 | mr1744 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 8.66E-22 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 2.07E-21 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 4.92E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 2.01E-26 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905464468 | NA | 6.59E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |