\
| Variant ID: vg0905437685 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5437685 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGCGATGAACATGGGCACACCTACAAGCATTGTCCTAAAGACAAGGAGAAACCAAATGCGGCGGAGGCAGGACTATCAGGATCAGCAGCAGATGGAGCT[C/T]
GCCCTACGGGTGAAGGCACTACCTCCTCTCGACCACGTCCTAGGCGTCGTCGTGCCACGTCTGGATACGTGGTGTAGTTCTTATGTTCTATGTTGGCATG
CATGCCAACATAGAACATAAGAACTACACCACGTATCCAGACGTGGCACGACGACGCCTAGGACGTGGTCGAGAGGAGGTAGTGCCTTCACCCGTAGGGC[G/A]
AGCTCCATCTGCTGCTGATCCTGATAGTCCTGCCTCCGCCGCATTTGGTTTCTCCTTGTCTTTAGGACAATGCTTGTAGGTGTGCCCATGTTCATCGCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 0.20% | 0.66% | 51.27% | NA |
| All Indica | 2759 | 14.00% | 0.40% | 1.05% | 84.60% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.00% | 0.66% | NA |
| Aus | 269 | 81.40% | 0.00% | 0.74% | 17.84% | NA |
| Indica I | 595 | 10.80% | 0.00% | 1.34% | 87.90% | NA |
| Indica II | 465 | 16.80% | 0.00% | 0.86% | 82.37% | NA |
| Indica III | 913 | 9.40% | 1.00% | 1.10% | 88.50% | NA |
| Indica Intermediate | 786 | 20.10% | 0.10% | 0.89% | 78.88% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 0.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905437685 | C -> DEL | LOC_Os09g09990.1 | N | frameshift_variant | Average:9.321; most accessible tissue: Callus, score: 18.428 | N | N | N | N |
| vg0905437685 | C -> T | LOC_Os09g09990.1 | missense_variant ; p.Arg754Cys; MODERATE | nonsynonymous_codon ; R754C | Average:9.321; most accessible tissue: Callus, score: 18.428 | probably damaging |
2.729 |
DELETERIOUS | 0.04 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905437685 | NA | 1.59E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905437685 | 6.21E-06 | 6.21E-06 | mr1171_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905437685 | NA | 1.55E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905437685 | 2.96E-06 | NA | mr1652_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905437685 | 4.42E-06 | 4.42E-06 | mr1652_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905437685 | NA | 9.43E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |