Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905341973:

Variant ID: vg0905341973 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5341973
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACGGGGTCCTCGGTGTGCCCACCAATCAATGTCGGGTTTTGACCTCAATCAGCATTGATGTGTTGTGTCATCAGTGCCGGGTTGTTGCTTACTCCCTCC[C/G]
TCCGTCCTAAAAAAAAGATTCTCATAAATAAAAAAGTAGTAAAAGTGATATGTAGTTAAAGGGTATTTAAGAGATAAAACTTCTCGTTTTATGTTCTGGA

Reverse complement sequence

TCCAGAACATAAAACGAGAAGTTTTATCTCTTAAATACCCTTTAACTACATATCACTTTTACTACTTTTTTATTTATGAGAATCTTTTTTTTAGGACGGA[G/C]
GGAGGGAGTAAGCAACAACCCGGCACTGATGACACAACACATCAATGCTGATTGAGGTCAAAACCCGACATTGATTGGTGGGCACACCGAGGACCCCGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	0.20%	21.67%	21.60%	NA
All Indica	2759	29.20%	0.30%	35.23%	35.23%	NA
All Japonica	1512	97.60%	0.10%	1.32%	0.99%	NA
Aus	269	85.90%	0.00%	7.81%	6.32%	NA
Indica I	595	26.90%	0.30%	50.92%	21.85%	NA
Indica II	465	29.50%	0.60%	28.82%	41.08%	NA
Indica III	913	29.10%	0.10%	27.05%	43.70%	NA
Indica Intermediate	786	31.00%	0.30%	36.64%	32.06%	NA
Temperate Japonica	767	99.30%	0.00%	0.52%	0.13%	NA
Tropical Japonica	504	95.20%	0.00%	2.78%	1.98%	NA
Japonica Intermediate	241	97.10%	0.40%	0.83%	1.66%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	71.10%	1.10%	11.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905341973	C -> G	LOC_Os09g09830-LOC_Os09g09850	intergenic_region ; MODIFIER	silent_mutation	Average:88.019; most accessible tissue: Callus, score: 97.45	N	N	N	N
vg0905341973	C -> DEL	N	N	silent_mutation	Average:88.019; most accessible tissue: Callus, score: 97.45	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0905341973	C	G	-0.09	-0.14	-0.08	-0.04	-0.06	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905341973	3.47E-06	NA	mr1077	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905341973	3.09E-06	2.10E-06	mr1322	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905341973	5.06E-06	7.14E-06	mr1712	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251