\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905326525:

Variant ID: vg0905326525 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5326525
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGTGTAGACAAAACTACATATTTAAGATCAAATTTATATTAAAAAATAGATTTAGAGCTAAGTATAGCAAAACCATATATTTAAAAATAAAGTTATC[G/A]
CAAAACTACAGAGTTTAGAGTTTATATCCCTAACAATAATATTATTACAGTTTTGAATATCCATCTTTTTATAAAATTGGAGCTACAGTTTTGTGATAAG

Reverse complement sequence

CTTATCACAAAACTGTAGCTCCAATTTTATAAAAAGATGGATATTCAAAACTGTAATAATATTATTGTTAGGGATATAAACTCTAAACTCTGTAGTTTTG[C/T]
GATAACTTTATTTTTAAATATATGGTTTTGCTATACTTAGCTCTAAATCTATTTTTTAATATAAATTTGATCTTAAATATGTAGTTTTGTCTACACCACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.40% 0.30% 0.00% NA
All Indica  2759 92.10% 7.50% 0.40% 0.00% NA
All Japonica  1512 2.40% 97.50% 0.07% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 95.50% 3.90% 0.67% 0.00% NA
Indica II  465 91.00% 8.40% 0.65% 0.00% NA
Indica III  913 94.60% 5.40% 0.00% 0.00% NA
Indica Intermediate  786 87.20% 12.30% 0.51% 0.00% NA
Temperate Japonica  767 1.20% 98.70% 0.13% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905326525 G -> A LOC_Os09g09820.1 downstream_gene_variant ; 2687.0bp to feature; MODIFIER silent_mutation Average:26.831; most accessible tissue: Callus, score: 52.56 N N N N
vg0905326525 G -> A LOC_Os09g09830.1 downstream_gene_variant ; 945.0bp to feature; MODIFIER silent_mutation Average:26.831; most accessible tissue: Callus, score: 52.56 N N N N
vg0905326525 G -> A LOC_Os09g09830.2 downstream_gene_variant ; 945.0bp to feature; MODIFIER silent_mutation Average:26.831; most accessible tissue: Callus, score: 52.56 N N N N
vg0905326525 G -> A LOC_Os09g09820-LOC_Os09g09830 intergenic_region ; MODIFIER silent_mutation Average:26.831; most accessible tissue: Callus, score: 52.56 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905326525 NA 3.12E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 4.80E-14 mr1010 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.28E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.54E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 2.17E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.21E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.16E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 2.73E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 5.73E-21 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 4.08E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 3.69E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 6.29E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.39E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 3.09E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 3.96E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 4.41E-32 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 9.19E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.65E-35 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 5.01E-38 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 1.43E-21 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 9.08E-34 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 4.62E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905326525 NA 7.22E-34 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251