Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0905265793:

Variant ID: vg0905265793 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5265793
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTCAAAGCTCTCGAAAAAAATTGAGAAAATATAAAAAATAAAAAATGGTTATTCCAAGTGCAATCATGACATCATTGCATTTGTACTTTATTGTTATT[T/A]
TTTCTCTTTTACATTCTTGATGAAATCATTGTCAAAGGGGGAGAAATATACAAAATGCATACTTCTTGAAAGGGGGAGAATTGAACTTTGTTTCGATTTT

Reverse complement sequence

AAAATCGAAACAAAGTTCAATTCTCCCCCTTTCAAGAAGTATGCATTTTGTATATTTCTCCCCCTTTGACAATGATTTCATCAAGAATGTAAAAGAGAAA[A/T]
AATAACAATAAAGTACAAATGCAATGATGTCATGATTGCACTTGGAATAACCATTTTTTATTTTTTATATTTTCTCAATTTTTTTCGAGAGCTTTGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	6.60%	0.30%	60.54%	NA
All Indica	2759	8.10%	5.10%	0.40%	86.41%	NA
All Japonica	1512	80.20%	0.10%	0.07%	19.64%	NA
Aus	269	21.90%	60.60%	0.00%	17.47%	NA
Indica I	595	13.60%	0.30%	0.67%	85.38%	NA
Indica II	465	9.70%	7.10%	0.22%	83.01%	NA
Indica III	913	3.20%	3.30%	0.11%	93.43%	NA
Indica Intermediate	786	8.70%	9.70%	0.64%	81.04%	NA
Temperate Japonica	767	89.80%	0.00%	0.00%	10.17%	NA
Tropical Japonica	504	81.50%	0.20%	0.20%	18.06%	NA
Japonica Intermediate	241	46.50%	0.40%	0.00%	53.11%	NA
VI/Aromatic	96	4.20%	4.20%	1.04%	90.62%	NA
Intermediate	90	47.80%	0.00%	1.11%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905265793	T -> DEL	N	N	silent_mutation	Average:9.526; most accessible tissue: Callus, score: 41.277	N	N	N	N
vg0905265793	T -> A	LOC_Os09g09730.1	upstream_gene_variant ; 2088.0bp to feature; MODIFIER	silent_mutation	Average:9.526; most accessible tissue: Callus, score: 41.277	N	N	N	N
vg0905265793	T -> A	LOC_Os09g09720.1	downstream_gene_variant ; 2655.0bp to feature; MODIFIER	silent_mutation	Average:9.526; most accessible tissue: Callus, score: 41.277	N	N	N	N
vg0905265793	T -> A	LOC_Os09g09720-LOC_Os09g09730	intergenic_region ; MODIFIER	silent_mutation	Average:9.526; most accessible tissue: Callus, score: 41.277	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905265793	NA	3.36E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	2.15E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	2.29E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	3.48E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	1.51E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	2.04E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	2.31E-09	mr1600_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	1.79E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	1.13E-30	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905265793	NA	6.88E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251