Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905251599:

Variant ID: vg0905251599 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5251599
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGCAATAAAGTATCAAAGTGTCTCAGTCGATTACAAAAGTTCTAAGTCTTATTACATAAAGATTATTGAGATAAGTATCGCTGGATGGCCGATATAGC[C/A,T]
TTCTGCCTAATCTGCTCTACTTCTTCTATGGCTTGGGCATCCTAAGCATCGGTTCCAGGGATAACTTTTAGAGACTTGGTCAGATCAGCAACATATTTGA

Reverse complement sequence

TCAAATATGTTGCTGATCTGACCAAGTCTCTAAAAGTTATCCCTGGAACCGATGCTTAGGATGCCCAAGCCATAGAAGAAGTAGAGCAGATTAGGCAGAA[G/T,A]
GCTATATCGGCCATCCAGCGATACTTATCTCAATAATCTTTATGTAATAAGACTTAGAACTTTTGTAATCGACTGAGACACTTTGATACTTTATTGCCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	10.30%	3.15%	2.54%	T: 0.02%
All Indica	2759	78.10%	17.50%	4.39%	0.00%	NA
All Japonica	1512	90.70%	0.10%	1.32%	7.80%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	49.20%	41.30%	9.41%	0.00%	NA
Indica II	465	91.40%	6.70%	1.94%	0.00%	NA
Indica III	913	89.90%	7.80%	2.30%	0.00%	NA
Indica Intermediate	786	78.50%	17.00%	4.45%	0.00%	NA
Temperate Japonica	767	94.70%	0.00%	0.26%	5.08%	NA
Tropical Japonica	504	97.20%	0.20%	0.00%	2.58%	NA
Japonica Intermediate	241	64.70%	0.40%	7.47%	27.39%	NA
VI/Aromatic	96	91.70%	0.00%	5.21%	2.08%	T: 1.04%
Intermediate	90	93.30%	4.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905251599	C -> DEL	N	N	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0905251599	C -> T	LOC_Os09g09700.1	downstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0905251599	C -> T	LOC_Os09g09710.1	downstream_gene_variant ; 42.0bp to feature; MODIFIER	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0905251599	C -> T	LOC_Os09g09700-LOC_Os09g09710	intergenic_region ; MODIFIER	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0905251599	C -> A	LOC_Os09g09700.1	downstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0905251599	C -> A	LOC_Os09g09710.1	downstream_gene_variant ; 42.0bp to feature; MODIFIER	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0905251599	C -> A	LOC_Os09g09700-LOC_Os09g09710	intergenic_region ; MODIFIER	silent_mutation	Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905251599	NA	1.86E-15	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	5.52E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	3.68E-12	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	4.25E-16	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	3.34E-14	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	3.42E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	1.69E-18	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	5.33E-21	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	2.38E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	8.03E-34	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	2.71E-18	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	1.76E-24	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	2.13E-20	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	3.24E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	1.79E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	1.77E-10	mr1531_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	7.50E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599	NA	1.87E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251