\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905251599:

Variant ID: vg0905251599 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5251599
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGCAATAAAGTATCAAAGTGTCTCAGTCGATTACAAAAGTTCTAAGTCTTATTACATAAAGATTATTGAGATAAGTATCGCTGGATGGCCGATATAGC[C/A,T]
TTCTGCCTAATCTGCTCTACTTCTTCTATGGCTTGGGCATCCTAAGCATCGGTTCCAGGGATAACTTTTAGAGACTTGGTCAGATCAGCAACATATTTGA

Reverse complement sequence

TCAAATATGTTGCTGATCTGACCAAGTCTCTAAAAGTTATCCCTGGAACCGATGCTTAGGATGCCCAAGCCATAGAAGAAGTAGAGCAGATTAGGCAGAA[G/T,A]
GCTATATCGGCCATCCAGCGATACTTATCTCAATAATCTTTATGTAATAAGACTTAGAACTTTTGTAATCGACTGAGACACTTTGATACTTTATTGCCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 10.30% 3.15% 2.54% T: 0.02%
All Indica  2759 78.10% 17.50% 4.39% 0.00% NA
All Japonica  1512 90.70% 0.10% 1.32% 7.80% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 49.20% 41.30% 9.41% 0.00% NA
Indica II  465 91.40% 6.70% 1.94% 0.00% NA
Indica III  913 89.90% 7.80% 2.30% 0.00% NA
Indica Intermediate  786 78.50% 17.00% 4.45% 0.00% NA
Temperate Japonica  767 94.70% 0.00% 0.26% 5.08% NA
Tropical Japonica  504 97.20% 0.20% 0.00% 2.58% NA
Japonica Intermediate  241 64.70% 0.40% 7.47% 27.39% NA
VI/Aromatic  96 91.70% 0.00% 5.21% 2.08% T: 1.04%
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905251599 C -> DEL N N silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0905251599 C -> T LOC_Os09g09700.1 downstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0905251599 C -> T LOC_Os09g09710.1 downstream_gene_variant ; 42.0bp to feature; MODIFIER silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0905251599 C -> T LOC_Os09g09700-LOC_Os09g09710 intergenic_region ; MODIFIER silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0905251599 C -> A LOC_Os09g09700.1 downstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0905251599 C -> A LOC_Os09g09710.1 downstream_gene_variant ; 42.0bp to feature; MODIFIER silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0905251599 C -> A LOC_Os09g09700-LOC_Os09g09710 intergenic_region ; MODIFIER silent_mutation Average:31.04; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905251599 NA 1.86E-15 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 5.52E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 3.68E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 4.25E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 3.34E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 3.42E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 1.69E-18 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 5.33E-21 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 2.38E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 8.03E-34 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 2.71E-18 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 1.76E-24 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 2.13E-20 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 3.24E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 1.79E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 1.77E-10 mr1531_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 7.50E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905251599 NA 1.87E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251