Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905249361:

Variant ID: vg0905249361 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5249361
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTGGAGAAGTTATGCTTGTGTCTGTATTTTCCGTGTACAAGGTTGAGGCATTATCTATTATCTAACGAGTGCACCGTTATATGCAAAGCCGATGTAGT[C/T]
AGGTACATGCTATCGGCTCCAATATTAAAGGGAAGAGTTGGAAAGTGGATATTTTCCTTGACTGAGTTTGATCTTTGGTATGAATCACCGAAGGCGATTA

Reverse complement sequence

TAATCGCCTTCGGTGATTCATACCAAAGATCAAACTCAGTCAAGGAAAATATCCACTTTCCAACTCTTCCCTTTAATATTGGAGCCGATAGCATGTACCT[G/A]
ACTACATCGGCTTTGCATATAACGGTGCACTCGTTAGATAATAGATAATGCCTCAACCTTGTACACGGAAAATACAGACACAAGCATAACTTCTCCACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	10.00%	3.60%	1.90%	NA
All Indica	2759	79.60%	16.50%	3.91%	0.00%	NA
All Japonica	1512	89.50%	0.70%	3.84%	5.95%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	98.00%	0.70%	1.34%	0.00%	NA
Indica II	465	83.70%	14.60%	1.72%	0.00%	NA
Indica III	913	60.60%	32.40%	7.01%	0.00%	NA
Indica Intermediate	786	85.20%	11.20%	3.56%	0.00%	NA
Temperate Japonica	767	94.50%	0.10%	3.65%	1.69%	NA
Tropical Japonica	504	93.70%	1.80%	0.79%	3.77%	NA
Japonica Intermediate	241	64.70%	0.40%	10.79%	24.07%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905249361	C -> DEL	LOC_Os09g09700.1	N	frameshift_variant	Average:20.027; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0905249361	C -> T	LOC_Os09g09700.1	synonymous_variant ; p.Val580Val; LOW	synonymous_codon	Average:20.027; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905249361	NA	1.37E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	2.12E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	4.72E-08	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.83E-06	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	3.09E-12	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.06E-07	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	4.11E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.14E-08	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	4.36E-06	2.14E-09	mr1247	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	7.79E-17	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	4.71E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.25E-12	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.30E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.19E-12	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	2.63E-11	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	5.90E-06	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.61E-14	mr1113_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	8.55E-06	6.49E-15	mr1114_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	7.85E-11	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	2.45E-07	1.84E-14	mr1118_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	2.09E-09	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.82E-13	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	2.58E-09	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	3.26E-13	mr1247_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.52E-07	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	8.95E-09	3.37E-18	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	7.42E-06	1.78E-20	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	4.54E-06	2.70E-17	mr1794_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905249361	NA	1.75E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251