| Variant ID: vg0905249361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5249361 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 286. )
TTGTGGAGAAGTTATGCTTGTGTCTGTATTTTCCGTGTACAAGGTTGAGGCATTATCTATTATCTAACGAGTGCACCGTTATATGCAAAGCCGATGTAGT[C/T]
AGGTACATGCTATCGGCTCCAATATTAAAGGGAAGAGTTGGAAAGTGGATATTTTCCTTGACTGAGTTTGATCTTTGGTATGAATCACCGAAGGCGATTA
TAATCGCCTTCGGTGATTCATACCAAAGATCAAACTCAGTCAAGGAAAATATCCACTTTCCAACTCTTCCCTTTAATATTGGAGCCGATAGCATGTACCT[G/A]
ACTACATCGGCTTTGCATATAACGGTGCACTCGTTAGATAATAGATAATGCCTCAACCTTGTACACGGAAAATACAGACACAAGCATAACTTCTCCACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 10.00% | 3.60% | 1.90% | NA |
| All Indica | 2759 | 79.60% | 16.50% | 3.91% | 0.00% | NA |
| All Japonica | 1512 | 89.50% | 0.70% | 3.84% | 5.95% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.00% | 0.70% | 1.34% | 0.00% | NA |
| Indica II | 465 | 83.70% | 14.60% | 1.72% | 0.00% | NA |
| Indica III | 913 | 60.60% | 32.40% | 7.01% | 0.00% | NA |
| Indica Intermediate | 786 | 85.20% | 11.20% | 3.56% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 0.10% | 3.65% | 1.69% | NA |
| Tropical Japonica | 504 | 93.70% | 1.80% | 0.79% | 3.77% | NA |
| Japonica Intermediate | 241 | 64.70% | 0.40% | 10.79% | 24.07% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905249361 | C -> DEL | LOC_Os09g09700.1 | N | frameshift_variant | Average:20.027; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0905249361 | C -> T | LOC_Os09g09700.1 | synonymous_variant ; p.Val580Val; LOW | synonymous_codon | Average:20.027; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905249361 | NA | 1.37E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 2.12E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 4.72E-08 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 1.83E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 3.09E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 1.06E-07 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 4.11E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 1.14E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | 4.36E-06 | 2.14E-09 | mr1247 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905249361 | NA | 7.79E-17 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/