\
| Variant ID: vg0905240849 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5240849 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTCATAGCTTAGACCAAACGGAGACAATCTAAGATTGAGATTAATAAAGATAAAAAATAGATAATAATATGATATTGAATATTAGCTGATGTAGTGATT[C/T]
AGATGATAGCAGATTGATAACTCATCGGCTGAAACTCCAATGAAACCTTAGACAAAATTTAACGATTTGTGCAAATCTACTTAAGTATCAGAATCTAGTA
TACTAGATTCTGATACTTAAGTAGATTTGCACAAATCGTTAAATTTTGTCTAAGGTTTCATTGGAGTTTCAGCCGATGAGTTATCAATCTGCTATCATCT[G/A]
AATCACTACATCAGCTAATATTCAATATCATATTATTATCTATTTTTTATCTTTATTAATCTCAATCTTAGATTGTCTCCGTTTGGTCTAAGCTATGAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 7.10% | 0.49% | 48.75% | NA |
| All Indica | 2759 | 13.80% | 5.10% | 0.72% | 80.36% | NA |
| All Japonica | 1512 | 98.10% | 1.10% | 0.00% | 0.79% | NA |
| Aus | 269 | 23.00% | 59.10% | 1.12% | 16.73% | NA |
| Indica I | 595 | 20.50% | 0.30% | 1.34% | 77.82% | NA |
| Indica II | 465 | 17.20% | 6.90% | 1.29% | 74.62% | NA |
| Indica III | 913 | 6.70% | 3.30% | 0.11% | 89.92% | NA |
| Indica Intermediate | 786 | 15.00% | 9.80% | 0.64% | 74.55% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 78.10% | 19.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 66.70% | 2.20% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905240849 | C -> DEL | N | N | silent_mutation | Average:12.415; most accessible tissue: Callus, score: 41.746 | N | N | N | N |
| vg0905240849 | C -> T | LOC_Os09g09690.1 | upstream_gene_variant ; 4503.0bp to feature; MODIFIER | silent_mutation | Average:12.415; most accessible tissue: Callus, score: 41.746 | N | N | N | N |
| vg0905240849 | C -> T | LOC_Os09g09690-LOC_Os09g09700 | intergenic_region ; MODIFIER | silent_mutation | Average:12.415; most accessible tissue: Callus, score: 41.746 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905240849 | NA | 1.46E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905240849 | 3.22E-06 | NA | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905240849 | NA | 1.90E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905240849 | NA | 9.78E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |