\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905240849:

Variant ID: vg0905240849 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5240849
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCATAGCTTAGACCAAACGGAGACAATCTAAGATTGAGATTAATAAAGATAAAAAATAGATAATAATATGATATTGAATATTAGCTGATGTAGTGATT[C/T]
AGATGATAGCAGATTGATAACTCATCGGCTGAAACTCCAATGAAACCTTAGACAAAATTTAACGATTTGTGCAAATCTACTTAAGTATCAGAATCTAGTA

Reverse complement sequence

TACTAGATTCTGATACTTAAGTAGATTTGCACAAATCGTTAAATTTTGTCTAAGGTTTCATTGGAGTTTCAGCCGATGAGTTATCAATCTGCTATCATCT[G/A]
AATCACTACATCAGCTAATATTCAATATCATATTATTATCTATTTTTTATCTTTATTAATCTCAATCTTAGATTGTCTCCGTTTGGTCTAAGCTATGAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 7.10% 0.49% 48.75% NA
All Indica  2759 13.80% 5.10% 0.72% 80.36% NA
All Japonica  1512 98.10% 1.10% 0.00% 0.79% NA
Aus  269 23.00% 59.10% 1.12% 16.73% NA
Indica I  595 20.50% 0.30% 1.34% 77.82% NA
Indica II  465 17.20% 6.90% 1.29% 74.62% NA
Indica III  913 6.70% 3.30% 0.11% 89.92% NA
Indica Intermediate  786 15.00% 9.80% 0.64% 74.55% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 98.80% 0.20% 0.00% 0.99% NA
Japonica Intermediate  241 92.90% 6.20% 0.00% 0.83% NA
VI/Aromatic  96 78.10% 19.80% 0.00% 2.08% NA
Intermediate  90 66.70% 2.20% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905240849 C -> DEL N N silent_mutation Average:12.415; most accessible tissue: Callus, score: 41.746 N N N N
vg0905240849 C -> T LOC_Os09g09690.1 upstream_gene_variant ; 4503.0bp to feature; MODIFIER silent_mutation Average:12.415; most accessible tissue: Callus, score: 41.746 N N N N
vg0905240849 C -> T LOC_Os09g09690-LOC_Os09g09700 intergenic_region ; MODIFIER silent_mutation Average:12.415; most accessible tissue: Callus, score: 41.746 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905240849 NA 1.46E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905240849 3.22E-06 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905240849 NA 1.90E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905240849 NA 9.78E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251