Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0905240849:

Variant ID: vg0905240849 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5240849
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCATAGCTTAGACCAAACGGAGACAATCTAAGATTGAGATTAATAAAGATAAAAAATAGATAATAATATGATATTGAATATTAGCTGATGTAGTGATT[C/T]
AGATGATAGCAGATTGATAACTCATCGGCTGAAACTCCAATGAAACCTTAGACAAAATTTAACGATTTGTGCAAATCTACTTAAGTATCAGAATCTAGTA

Reverse complement sequence

TACTAGATTCTGATACTTAAGTAGATTTGCACAAATCGTTAAATTTTGTCTAAGGTTTCATTGGAGTTTCAGCCGATGAGTTATCAATCTGCTATCATCT[G/A]
AATCACTACATCAGCTAATATTCAATATCATATTATTATCTATTTTTTATCTTTATTAATCTCAATCTTAGATTGTCTCCGTTTGGTCTAAGCTATGAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.60%	7.10%	0.49%	48.75%	NA
All Indica	2759	13.80%	5.10%	0.72%	80.36%	NA
All Japonica	1512	98.10%	1.10%	0.00%	0.79%	NA
Aus	269	23.00%	59.10%	1.12%	16.73%	NA
Indica I	595	20.50%	0.30%	1.34%	77.82%	NA
Indica II	465	17.20%	6.90%	1.29%	74.62%	NA
Indica III	913	6.70%	3.30%	0.11%	89.92%	NA
Indica Intermediate	786	15.00%	9.80%	0.64%	74.55%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	98.80%	0.20%	0.00%	0.99%	NA
Japonica Intermediate	241	92.90%	6.20%	0.00%	0.83%	NA
VI/Aromatic	96	78.10%	19.80%	0.00%	2.08%	NA
Intermediate	90	66.70%	2.20%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905240849	C -> DEL	N	N	silent_mutation	Average:12.415; most accessible tissue: Callus, score: 41.746	N	N	N	N
vg0905240849	C -> T	LOC_Os09g09690.1	upstream_gene_variant ; 4503.0bp to feature; MODIFIER	silent_mutation	Average:12.415; most accessible tissue: Callus, score: 41.746	N	N	N	N
vg0905240849	C -> T	LOC_Os09g09690-LOC_Os09g09700	intergenic_region ; MODIFIER	silent_mutation	Average:12.415; most accessible tissue: Callus, score: 41.746	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905240849	NA	1.46E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905240849	3.22E-06	NA	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905240849	NA	1.90E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905240849	NA	9.78E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251