\
| Variant ID: vg0905114178 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5114178 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATAATGGGCCACTAATTTAAGTTGAAAATTGAAGGTTGGATTTTTTTTTACTCTAAATTTCTAGGATTTCTCTAAATTAGAGCGTCACGTGATAACGTA[G/A]
GAGCGTTCAGGAAGTTTAATAGACTTTTAGTATATAATAGATTTCTAGGATTTTTCTAATTTATTTGAGAGTCACATAGCAGTGTAAAAGCATTTGTAGA
TCTACAAATGCTTTTACACTGCTATGTGACTCTCAAATAAATTAGAAAAATCCTAGAAATCTATTATATACTAAAAGTCTATTAAACTTCCTGAACGCTC[C/T]
TACGTTATCACGTGACGCTCTAATTTAGAGAAATCCTAGAAATTTAGAGTAAAAAAAAATCCAACCTTCAATTTTCAACTTAAATTAGTGGCCCATTATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 1.30% | 1.14% | 1.08% | NA |
| All Indica | 2759 | 96.10% | 2.20% | 1.56% | 0.14% | NA |
| All Japonica | 1512 | 98.90% | 0.10% | 0.13% | 0.93% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 95.00% | 1.50% | 3.53% | 0.00% | NA |
| Indica II | 465 | 93.10% | 4.90% | 1.94% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 94.50% | 3.60% | 1.53% | 0.38% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 94.20% | 0.00% | 0.41% | 5.39% | NA |
| VI/Aromatic | 96 | 63.50% | 0.00% | 8.33% | 28.12% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905114178 | G -> DEL | N | N | silent_mutation | Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416 | N | N | N | N |
| vg0905114178 | G -> A | LOC_Os09g09490.1 | downstream_gene_variant ; 1220.0bp to feature; MODIFIER | silent_mutation | Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416 | N | N | N | N |
| vg0905114178 | G -> A | LOC_Os09g09490-LOC_Os09g09500 | intergenic_region ; MODIFIER | silent_mutation | Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905114178 | 4.71E-07 | NA | mr1101 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 9.23E-06 | mr1209 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 2.08E-08 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 2.55E-06 | mr1222 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 1.83E-06 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 1.99E-06 | mr1816 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 8.22E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 1.70E-10 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 9.84E-06 | mr1500_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905114178 | NA | 6.25E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |