Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905114178:

Variant ID: vg0905114178 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 5114178
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAATGGGCCACTAATTTAAGTTGAAAATTGAAGGTTGGATTTTTTTTTACTCTAAATTTCTAGGATTTCTCTAAATTAGAGCGTCACGTGATAACGTA[G/A]
GAGCGTTCAGGAAGTTTAATAGACTTTTAGTATATAATAGATTTCTAGGATTTTTCTAATTTATTTGAGAGTCACATAGCAGTGTAAAAGCATTTGTAGA

Reverse complement sequence

TCTACAAATGCTTTTACACTGCTATGTGACTCTCAAATAAATTAGAAAAATCCTAGAAATCTATTATATACTAAAAGTCTATTAAACTTCCTGAACGCTC[C/T]
TACGTTATCACGTGACGCTCTAATTTAGAGAAATCCTAGAAATTTAGAGTAAAAAAAAATCCAACCTTCAATTTTCAACTTAAATTAGTGGCCCATTATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	1.30%	1.14%	1.08%	NA
All Indica	2759	96.10%	2.20%	1.56%	0.14%	NA
All Japonica	1512	98.90%	0.10%	0.13%	0.93%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	95.00%	1.50%	3.53%	0.00%	NA
Indica II	465	93.10%	4.90%	1.94%	0.00%	NA
Indica III	913	99.80%	0.00%	0.11%	0.11%	NA
Indica Intermediate	786	94.50%	3.60%	1.53%	0.38%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	94.20%	0.00%	0.41%	5.39%	NA
VI/Aromatic	96	63.50%	0.00%	8.33%	28.12%	NA
Intermediate	90	92.20%	2.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0905114178	G -> DEL	N	N	silent_mutation	Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416	N	N	N	N
vg0905114178	G -> A	LOC_Os09g09490.1	downstream_gene_variant ; 1220.0bp to feature; MODIFIER	silent_mutation	Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416	N	N	N	N
vg0905114178	G -> A	LOC_Os09g09490-LOC_Os09g09500	intergenic_region ; MODIFIER	silent_mutation	Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0905114178	4.71E-07	NA	mr1101	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	9.23E-06	mr1209	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	2.08E-08	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	2.55E-06	mr1222	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	1.83E-06	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	1.99E-06	mr1816	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	8.22E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	1.70E-10	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	9.84E-06	mr1500_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178	NA	6.25E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251