\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905114178:

Variant ID: vg0905114178 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5114178
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAATGGGCCACTAATTTAAGTTGAAAATTGAAGGTTGGATTTTTTTTTACTCTAAATTTCTAGGATTTCTCTAAATTAGAGCGTCACGTGATAACGTA[G/A]
GAGCGTTCAGGAAGTTTAATAGACTTTTAGTATATAATAGATTTCTAGGATTTTTCTAATTTATTTGAGAGTCACATAGCAGTGTAAAAGCATTTGTAGA

Reverse complement sequence

TCTACAAATGCTTTTACACTGCTATGTGACTCTCAAATAAATTAGAAAAATCCTAGAAATCTATTATATACTAAAAGTCTATTAAACTTCCTGAACGCTC[C/T]
TACGTTATCACGTGACGCTCTAATTTAGAGAAATCCTAGAAATTTAGAGTAAAAAAAAATCCAACCTTCAATTTTCAACTTAAATTAGTGGCCCATTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.40% 1.30% 1.14% 1.08% NA
All Indica  2759 96.10% 2.20% 1.56% 0.14% NA
All Japonica  1512 98.90% 0.10% 0.13% 0.93% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 95.00% 1.50% 3.53% 0.00% NA
Indica II  465 93.10% 4.90% 1.94% 0.00% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 94.50% 3.60% 1.53% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 94.20% 0.00% 0.41% 5.39% NA
VI/Aromatic  96 63.50% 0.00% 8.33% 28.12% NA
Intermediate  90 92.20% 2.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905114178 G -> DEL N N silent_mutation Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0905114178 G -> A LOC_Os09g09490.1 downstream_gene_variant ; 1220.0bp to feature; MODIFIER silent_mutation Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0905114178 G -> A LOC_Os09g09490-LOC_Os09g09500 intergenic_region ; MODIFIER silent_mutation Average:29.717; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905114178 4.71E-07 NA mr1101 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 9.23E-06 mr1209 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 2.08E-08 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 2.55E-06 mr1222 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 1.83E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 1.99E-06 mr1816 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 8.22E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 1.70E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 9.84E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905114178 NA 6.25E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251