\
| Variant ID: vg0905075837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5075837 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATCTAGTGTGTGTTGTAACGCCCCGATTTTCGTTCGGGTTTTAAAATCATTTAATAATGCATTTCAAGAAATTATATTAAAAGTTAAAGCAATTTATTC[G/A]
AGTGAATTAATGGGAGAATTAAAATTTTCCCTTAAAAATCATTGGCCGGGAATATTTTGCAATATTCTTTTGCCCTAAAATACTCTCTGAAATTTCCTGT
ACAGGAAATTTCAGAGAGTATTTTAGGGCAAAAGAATATTGCAAAATATTCCCGGCCAATGATTTTTAAGGGAAAATTTTAATTCTCCCATTAATTCACT[C/T]
GAATAAATTGCTTTAACTTTTAATATAATTTCTTGAAATGCATTATTAAATGATTTTAAAACCCGAACGAAAATCGGGGCGTTACAACACACACTAGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 8.10% | 1.99% | 1.29% | NA |
| All Indica | 2759 | 91.90% | 7.50% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 91.50% | 0.20% | 4.30% | 3.97% | NA |
| Aus | 269 | 38.30% | 61.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 5.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 11.70% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 85.80% | 0.00% | 7.43% | 6.78% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.40% | 3.32% | 2.49% | NA |
| VI/Aromatic | 96 | 84.40% | 5.20% | 10.42% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905075837 | G -> DEL | N | N | silent_mutation | Average:37.705; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0905075837 | G -> A | LOC_Os09g09430.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.705; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905075837 | NA | 1.61E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | 7.82E-06 | 4.74E-08 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | NA | 6.58E-06 | mr1306_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | NA | 5.22E-06 | mr1381_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | NA | 3.22E-07 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | NA | 8.35E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | NA | 3.85E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | 3.45E-06 | NA | mr1783_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | 5.83E-06 | NA | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | 7.11E-06 | NA | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | 1.23E-07 | NA | mr1874_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905075837 | 9.19E-06 | 9.18E-06 | mr1953_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |