\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904941915:

Variant ID: vg0904941915 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4941915
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTTTAGAGCTGGTCACGGGGAAGTCACCCATCCTTCGTACCCCGGAGCCAATCAGCCTTATCCATTGGGCACAACAGCGCATGCAATGTGGAAACAT[C/T]
GAGGGTGTGGTGGATGCACGCATGCACGGTGTCTATGATGTCAACAGTGTCTGGAAGGTTGCAGAGATAGGACTAATGTGCACTGCACAGGCATCGGCAC

Reverse complement sequence

GTGCCGATGCCTGTGCAGTGCACATTAGTCCTATCTCTGCAACCTTCCAGACACTGTTGACATCATAGACACCGTGCATGCGTGCATCCACCACACCCTC[G/A]
ATGTTTCCACATTGCATGCGCTGTTGTGCCCAATGGATAAGGCTGATTGGCTCCGGGGTACGAAGGATGGGTGACTTCCCCGTGACCAGCTCTAAAAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 0.70% 0.95% 18.18% NA
All Indica  2759 94.10% 0.20% 0.51% 5.26% NA
All Japonica  1512 65.50% 1.30% 1.19% 32.01% NA
Aus  269 32.70% 3.70% 4.09% 59.48% NA
Indica I  595 97.00% 0.20% 0.84% 2.02% NA
Indica II  465 93.50% 0.00% 0.86% 5.59% NA
Indica III  913 95.90% 0.00% 0.11% 3.94% NA
Indica Intermediate  786 89.90% 0.50% 0.51% 9.03% NA
Temperate Japonica  767 98.30% 0.00% 0.13% 1.56% NA
Tropical Japonica  504 20.80% 3.20% 2.98% 73.02% NA
Japonica Intermediate  241 54.80% 1.20% 0.83% 43.15% NA
VI/Aromatic  96 43.80% 1.00% 0.00% 55.21% NA
Intermediate  90 78.90% 0.00% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904941915 C -> DEL LOC_Os09g09220.1 N frameshift_variant Average:67.321; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0904941915 C -> T LOC_Os09g09220.1 synonymous_variant ; p.Ile748Ile; LOW synonymous_codon Average:67.321; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904941915 NA 4.84E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 1.65E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 9.34E-07 9.35E-07 mr1177_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 8.41E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 6.06E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 1.89E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 1.93E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 3.67E-06 3.67E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 4.40E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 6.94E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 9.58E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 5.85E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 2.10E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 2.99E-09 mr1456_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 2.71E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 4.61E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 5.21E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 7.88E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 4.79E-10 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 6.90E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 1.65E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 4.55E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 3.32E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 5.41E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904941915 NA 1.51E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251