\
| Variant ID: vg0904833940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 4833940 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 50. )
AAATTCTAGGAGAGAACTCCGATACTTTGGGGCACTCCTTCCGAGCTTCCCCTCACACTATTACTAAACTGACATACTAAAGTAAAGCTAACAAGTGAGT[G/C]
GTACTCTACTTGAGATCAAGTTGCATGTTTTCCAACTGTGAAGGCCTCCTCGTTACATAGTGTGCCAATGACAGTTGGAATGGTGGCTAGGGAGGTCGAT
ATCGACCTCCCTAGCCACCATTCCAACTGTCATTGGCACACTATGTAACGAGGAGGCCTTCACAGTTGGAAAACATGCAACTTGATCTCAAGTAGAGTAC[C/G]
ACTCACTTGTTAGCTTTACTTTAGTATGTCAGTTTAGTAATAGTGTGAGGGGAAGCTCGGAAGGAGTGCCCCAAAGTATCGGAGTTCTCTCCTAGAATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 37.00% | 0.13% | 13.58% | NA |
| All Indica | 2759 | 80.60% | 15.70% | 0.11% | 3.62% | NA |
| All Japonica | 1512 | 2.90% | 73.40% | 0.07% | 23.61% | NA |
| Aus | 269 | 1.90% | 49.80% | 0.37% | 47.96% | NA |
| Indica I | 595 | 66.70% | 32.80% | 0.00% | 0.50% | NA |
| Indica II | 465 | 84.90% | 12.00% | 0.00% | 3.01% | NA |
| Indica III | 913 | 89.00% | 7.90% | 0.11% | 2.96% | NA |
| Indica Intermediate | 786 | 78.80% | 13.90% | 0.25% | 7.12% | NA |
| Temperate Japonica | 767 | 0.80% | 98.30% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 5.60% | 40.50% | 0.20% | 53.77% | NA |
| Japonica Intermediate | 241 | 4.10% | 63.10% | 0.00% | 32.78% | NA |
| VI/Aromatic | 96 | 11.50% | 41.70% | 0.00% | 46.88% | NA |
| Intermediate | 90 | 50.00% | 36.70% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904833940 | G -> DEL | N | N | silent_mutation | Average:45.795; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg0904833940 | G -> C | LOC_Os09g09060.1 | downstream_gene_variant ; 574.0bp to feature; MODIFIER | silent_mutation | Average:45.795; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| vg0904833940 | G -> C | LOC_Os09g09050-LOC_Os09g09060 | intergenic_region ; MODIFIER | silent_mutation | Average:45.795; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904833940 | NA | 4.17E-09 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 6.76E-09 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 4.80E-09 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 2.44E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 8.82E-06 | mr1189_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 3.41E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 3.48E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 2.27E-07 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 4.11E-09 | mr1277_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 2.49E-15 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 1.69E-11 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904833940 | NA | 4.25E-06 | mr1471_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |