Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904833561:

Variant ID: vg0904833561 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4833561
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCACACCTCTTATGGGCCACACATGCCTCATCCTAATTGGGCTAGGATATCCCAGTTGAGCACACAACAAACGAATGTAACTGCTAACCTAGACACCA[C/T]
GCCTAAGTTATTGATTACTATTCTAGCCTTGCACATGAACTTCCTTCTTTATCTAGAGTCCTACTACAAGAGCACTTAATTATAAACTAAGCTACGAACC

Reverse complement sequence

GGTTCGTAGCTTAGTTTATAATTAAGTGCTCTTGTAGTAGGACTCTAGATAAAGAAGGAAGTTCATGTGCAAGGCTAGAATAGTAATCAATAACTTAGGC[G/A]
TGGTGTCTAGGTTAGCAGTTACATTCGTTTGTTGTGTGCTCAACTGGGATATCCTAGCCCAATTAGGATGAGGCATGTGTGGCCCATAAGAGGTGTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	21.60%	0.23%	13.22%	NA
All Indica	2759	85.80%	10.60%	0.04%	3.55%	NA
All Japonica	1512	35.10%	41.50%	0.53%	22.88%	NA
Aus	269	21.60%	30.10%	0.00%	48.33%	NA
Indica I	595	74.30%	25.20%	0.00%	0.50%	NA
Indica II	465	95.90%	1.10%	0.00%	3.01%	NA
Indica III	913	89.90%	7.20%	0.00%	2.85%	NA
Indica Intermediate	786	83.80%	9.00%	0.13%	7.00%	NA
Temperate Japonica	767	40.20%	59.10%	0.00%	0.78%	NA
Tropical Japonica	504	28.80%	17.70%	0.79%	52.78%	NA
Japonica Intermediate	241	32.00%	35.70%	1.66%	30.71%	NA
VI/Aromatic	96	50.00%	5.20%	2.08%	42.71%	NA
Intermediate	90	73.30%	15.60%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904833561	C -> DEL	N	N	silent_mutation	Average:62.107; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N
vg0904833561	C -> T	LOC_Os09g09060.1	downstream_gene_variant ; 953.0bp to feature; MODIFIER	silent_mutation	Average:62.107; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N
vg0904833561	C -> T	LOC_Os09g09050-LOC_Os09g09060	intergenic_region ; MODIFIER	silent_mutation	Average:62.107; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904833561	NA	1.08E-06	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	1.19E-10	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	9.50E-06	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	1.62E-10	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	7.64E-11	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	4.97E-06	1.47E-07	mr1047_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	1.35E-06	1.67E-08	mr1189_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	3.88E-07	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	1.41E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	1.33E-08	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	1.07E-06	4.95E-08	mr1471_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	1.75E-06	2.73E-07	mr1642_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	7.93E-09	mr1722_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561	NA	1.37E-06	mr1815_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251