\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904833561:

Variant ID: vg0904833561 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4833561
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCACACCTCTTATGGGCCACACATGCCTCATCCTAATTGGGCTAGGATATCCCAGTTGAGCACACAACAAACGAATGTAACTGCTAACCTAGACACCA[C/T]
GCCTAAGTTATTGATTACTATTCTAGCCTTGCACATGAACTTCCTTCTTTATCTAGAGTCCTACTACAAGAGCACTTAATTATAAACTAAGCTACGAACC

Reverse complement sequence

GGTTCGTAGCTTAGTTTATAATTAAGTGCTCTTGTAGTAGGACTCTAGATAAAGAAGGAAGTTCATGTGCAAGGCTAGAATAGTAATCAATAACTTAGGC[G/A]
TGGTGTCTAGGTTAGCAGTTACATTCGTTTGTTGTGTGCTCAACTGGGATATCCTAGCCCAATTAGGATGAGGCATGTGTGGCCCATAAGAGGTGTGCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 21.60% 0.23% 13.22% NA
All Indica  2759 85.80% 10.60% 0.04% 3.55% NA
All Japonica  1512 35.10% 41.50% 0.53% 22.88% NA
Aus  269 21.60% 30.10% 0.00% 48.33% NA
Indica I  595 74.30% 25.20% 0.00% 0.50% NA
Indica II  465 95.90% 1.10% 0.00% 3.01% NA
Indica III  913 89.90% 7.20% 0.00% 2.85% NA
Indica Intermediate  786 83.80% 9.00% 0.13% 7.00% NA
Temperate Japonica  767 40.20% 59.10% 0.00% 0.78% NA
Tropical Japonica  504 28.80% 17.70% 0.79% 52.78% NA
Japonica Intermediate  241 32.00% 35.70% 1.66% 30.71% NA
VI/Aromatic  96 50.00% 5.20% 2.08% 42.71% NA
Intermediate  90 73.30% 15.60% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904833561 C -> DEL N N silent_mutation Average:62.107; most accessible tissue: Zhenshan97 young leaf, score: 85.364 N N N N
vg0904833561 C -> T LOC_Os09g09060.1 downstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:62.107; most accessible tissue: Zhenshan97 young leaf, score: 85.364 N N N N
vg0904833561 C -> T LOC_Os09g09050-LOC_Os09g09060 intergenic_region ; MODIFIER silent_mutation Average:62.107; most accessible tissue: Zhenshan97 young leaf, score: 85.364 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904833561 NA 1.08E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 1.19E-10 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 9.50E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 1.62E-10 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 7.64E-11 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 4.97E-06 1.47E-07 mr1047_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 1.35E-06 1.67E-08 mr1189_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 3.88E-07 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 1.41E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 1.33E-08 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 1.07E-06 4.95E-08 mr1471_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 1.75E-06 2.73E-07 mr1642_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 7.93E-09 mr1722_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904833561 NA 1.37E-06 mr1815_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251