Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904767635:

Variant ID: vg0904767635 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4767635
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAGCATCTTCGAAATCATCATCATCGGAATCGGCTGCACCACCTCTACCGGCTGTATCAGCTGTCCTCTGTCCGATCCATCTCAGCTGACGCAGACTC[C/T]
AGCCGATGCCTTCGCAGCCGATGCATACTCTGTTCTTCGAATCAATCTCGTTATCGAATCCGCTTCGATCCCAATGTCGAACCTGGTTTATAATTTACCA

Reverse complement sequence

TGGTAAATTATAAACCAGGTTCGACATTGGGATCGAAGCGGATTCGATAACGAGATTGATTCGAAGAACAGAGTATGCATCGGCTGCGAAGGCATCGGCT[G/A]
GAGTCTGCGTCAGCTGAGATGGATCGGACAGAGGACAGCTGATACAGCCGGTAGAGGTGGTGCAGCCGATTCCGATGATGATGATTTCGAAGATGCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	18.20%	0.04%	0.00%	NA
All Indica	2759	91.20%	8.80%	0.00%	0.00%	NA
All Japonica	1512	64.50%	35.40%	0.07%	0.00%	NA
Aus	269	81.80%	18.20%	0.00%	0.00%	NA
Indica I	595	79.50%	20.50%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	93.30%	6.70%	0.00%	0.00%	NA
Indica Intermediate	786	92.50%	7.50%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	19.20%	80.60%	0.20%	0.00%	NA
Japonica Intermediate	241	52.70%	47.30%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904767635	C -> T	LOC_Os09g08970.1	upstream_gene_variant ; 3773.0bp to feature; MODIFIER	silent_mutation	Average:55.624; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0904767635	C -> T	LOC_Os09g08960.1	downstream_gene_variant ; 1700.0bp to feature; MODIFIER	silent_mutation	Average:55.624; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0904767635	C -> T	LOC_Os09g08960-LOC_Os09g08970	intergenic_region ; MODIFIER	silent_mutation	Average:55.624; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904767635	NA	5.85E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904767635	NA	2.68E-07	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	2.11E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	1.23E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	1.43E-07	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	3.14E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	1.41E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	6.65E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	8.40E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	1.29E-06	mr1189_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	4.48E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	5.79E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	5.64E-08	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	4.87E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	7.17E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	1.47E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	2.80E-06	mr1471_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	9.25E-09	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	4.86E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	9.10E-06	mr1642_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	5.43E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	1.03E-07	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	2.64E-06	NA	mr1817_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904767635	NA	5.79E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251