Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0904766722:

Variant ID: vg0904766722 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4766722
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, C: 0.40, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGCATAGCCAATCAGATAGATCTAGCATGTATCGGGTAATACTCCGATACCACTCTATATTAAGATATTAAAGCAAGCAAAATATATCAAACAGAAAG[C/G]
TTAATATACCTAAATGCAACAAGATCTTAACATAAAGGGCAGATTTAACATATCAATCAAGCATGTAAGATATAAGGTAGTTAAATCAGGTAAGAACGGC

Reverse complement sequence

GCCGTTCTTACCTGATTTAACTACCTTATATCTTACATGCTTGATTGATATGTTAAATCTGCCCTTTATGTTAAGATCTTGTTGCATTTAGGTATATTAA[G/C]
CTTTCTGTTTGATATATTTTGCTTGCTTTAATATCTTAATATAGAGTGGTATCGGAGTATTACCCGATACATGCTAGATCTATCTGATTGGCTATGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.80%	21.60%	18.01%	32.61%	NA
All Indica	2759	8.70%	24.40%	21.02%	45.85%	NA
All Japonica	1512	63.20%	12.60%	13.29%	10.91%	NA
Aus	269	32.70%	16.00%	17.84%	33.46%	NA
Indica I	595	11.90%	28.10%	26.22%	33.78%	NA
Indica II	465	15.10%	16.30%	18.49%	50.11%	NA
Indica III	913	2.00%	28.30%	18.62%	51.15%	NA
Indica Intermediate	786	10.30%	22.00%	21.37%	46.31%	NA
Temperate Japonica	767	97.00%	0.70%	1.83%	0.52%	NA
Tropical Japonica	504	18.10%	27.80%	27.98%	26.19%	NA
Japonica Intermediate	241	49.80%	19.10%	19.09%	12.03%	NA
VI/Aromatic	96	15.60%	81.20%	1.04%	2.08%	NA
Intermediate	90	18.90%	36.70%	23.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904766722	C -> G	LOC_Os09g08970.1	upstream_gene_variant ; 4686.0bp to feature; MODIFIER	silent_mutation	Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075	N	N	N	N
vg0904766722	C -> G	LOC_Os09g08960.1	downstream_gene_variant ; 787.0bp to feature; MODIFIER	silent_mutation	Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075	N	N	N	N
vg0904766722	C -> G	LOC_Os09g08960-LOC_Os09g08970	intergenic_region ; MODIFIER	silent_mutation	Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075	N	N	N	N
vg0904766722	C -> DEL	N	N	silent_mutation	Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904766722	NA	6.42E-08	mr1098_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	5.74E-06	3.43E-08	mr1099_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	NA	2.01E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	6.06E-06	NA	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	1.35E-07	9.16E-10	mr1350_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	6.71E-06	6.70E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	9.33E-06	9.32E-06	mr1846_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	6.85E-06	2.08E-07	mr1853_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	NA	1.05E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722	NA	4.10E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251