\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904766722:

Variant ID: vg0904766722 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4766722
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, C: 0.40, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGCATAGCCAATCAGATAGATCTAGCATGTATCGGGTAATACTCCGATACCACTCTATATTAAGATATTAAAGCAAGCAAAATATATCAAACAGAAAG[C/G]
TTAATATACCTAAATGCAACAAGATCTTAACATAAAGGGCAGATTTAACATATCAATCAAGCATGTAAGATATAAGGTAGTTAAATCAGGTAAGAACGGC

Reverse complement sequence

GCCGTTCTTACCTGATTTAACTACCTTATATCTTACATGCTTGATTGATATGTTAAATCTGCCCTTTATGTTAAGATCTTGTTGCATTTAGGTATATTAA[G/C]
CTTTCTGTTTGATATATTTTGCTTGCTTTAATATCTTAATATAGAGTGGTATCGGAGTATTACCCGATACATGCTAGATCTATCTGATTGGCTATGCTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.80% 21.60% 18.01% 32.61% NA
All Indica  2759 8.70% 24.40% 21.02% 45.85% NA
All Japonica  1512 63.20% 12.60% 13.29% 10.91% NA
Aus  269 32.70% 16.00% 17.84% 33.46% NA
Indica I  595 11.90% 28.10% 26.22% 33.78% NA
Indica II  465 15.10% 16.30% 18.49% 50.11% NA
Indica III  913 2.00% 28.30% 18.62% 51.15% NA
Indica Intermediate  786 10.30% 22.00% 21.37% 46.31% NA
Temperate Japonica  767 97.00% 0.70% 1.83% 0.52% NA
Tropical Japonica  504 18.10% 27.80% 27.98% 26.19% NA
Japonica Intermediate  241 49.80% 19.10% 19.09% 12.03% NA
VI/Aromatic  96 15.60% 81.20% 1.04% 2.08% NA
Intermediate  90 18.90% 36.70% 23.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904766722 C -> G LOC_Os09g08970.1 upstream_gene_variant ; 4686.0bp to feature; MODIFIER silent_mutation Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0904766722 C -> G LOC_Os09g08960.1 downstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0904766722 C -> G LOC_Os09g08960-LOC_Os09g08970 intergenic_region ; MODIFIER silent_mutation Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0904766722 C -> DEL N N silent_mutation Average:28.915; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904766722 NA 6.42E-08 mr1098_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 5.74E-06 3.43E-08 mr1099_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 NA 2.01E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 6.06E-06 NA mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 1.35E-07 9.16E-10 mr1350_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 6.71E-06 6.70E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 9.33E-06 9.32E-06 mr1846_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 6.85E-06 2.08E-07 mr1853_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 NA 1.05E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904766722 NA 4.10E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251