\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904657901:

Variant ID: vg0904657901 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4657901
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACCTTAACAAGGTTGGATACTCGGACGAACCTTTTGTCCTTGCCAATGATGTAACACAAGTTTTTTATGTCAAGGACATGTCTAGCAAAGGAAAAAAG[G/A]
GCAAAGGGCCTGACGAGCCGAAGCGCCACGTGGTTCTCCCAGGAAAAAGAAAAATCGTCGGAGTAGAGGACAATACTGACGAGGATTACGATCAGTTTGA

Reverse complement sequence

TCAAACTGATCGTAATCCTCGTCAGTATTGTCCTCTACTCCGACGATTTTTCTTTTTCCTGGGAGAACCACGTGGCGCTTCGGCTCGTCAGGCCCTTTGC[C/T]
CTTTTTTCCTTTGCTAGACATGTCCTTGACATAAAAAACTTGTGTTACATCATTGGCAAGGACAAAAGGTTCGTCCGAGTATCCAACCTTGTTAAGGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 11.00% 15.91% 14.96% NA
All Indica  2759 45.00% 18.50% 22.22% 14.28% NA
All Japonica  1512 73.10% 0.20% 6.81% 19.84% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 49.90% 7.20% 28.57% 14.29% NA
Indica II  465 37.80% 38.70% 18.71% 4.73% NA
Indica III  913 43.60% 14.00% 18.51% 23.88% NA
Indica Intermediate  786 47.20% 20.20% 23.79% 8.78% NA
Temperate Japonica  767 97.90% 0.10% 0.39% 1.56% NA
Tropical Japonica  504 34.30% 0.00% 15.87% 49.80% NA
Japonica Intermediate  241 75.50% 0.80% 8.30% 15.35% NA
VI/Aromatic  96 82.30% 0.00% 13.54% 4.17% NA
Intermediate  90 57.80% 8.90% 23.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904657901 G -> DEL LOC_Os09g08830.1 N frameshift_variant Average:29.07; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0904657901 G -> A LOC_Os09g08830.1 missense_variant ; p.Gly655Ser; MODERATE nonsynonymous_codon ; G655S Average:29.07; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904657901 NA 4.78E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904657901 NA 1.79E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904657901 NA 3.33E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904657901 NA 2.58E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904657901 1.17E-06 3.72E-09 mr1347 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904657901 4.35E-06 4.35E-06 mr1596 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251