\
| Variant ID: vg0904657901 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 4657901 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGACCTTAACAAGGTTGGATACTCGGACGAACCTTTTGTCCTTGCCAATGATGTAACACAAGTTTTTTATGTCAAGGACATGTCTAGCAAAGGAAAAAAG[G/A]
GCAAAGGGCCTGACGAGCCGAAGCGCCACGTGGTTCTCCCAGGAAAAAGAAAAATCGTCGGAGTAGAGGACAATACTGACGAGGATTACGATCAGTTTGA
TCAAACTGATCGTAATCCTCGTCAGTATTGTCCTCTACTCCGACGATTTTTCTTTTTCCTGGGAGAACCACGTGGCGCTTCGGCTCGTCAGGCCCTTTGC[C/T]
CTTTTTTCCTTTGCTAGACATGTCCTTGACATAAAAAACTTGTGTTACATCATTGGCAAGGACAAAAGGTTCGTCCGAGTATCCAACCTTGTTAAGGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 11.00% | 15.91% | 14.96% | NA |
| All Indica | 2759 | 45.00% | 18.50% | 22.22% | 14.28% | NA |
| All Japonica | 1512 | 73.10% | 0.20% | 6.81% | 19.84% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 49.90% | 7.20% | 28.57% | 14.29% | NA |
| Indica II | 465 | 37.80% | 38.70% | 18.71% | 4.73% | NA |
| Indica III | 913 | 43.60% | 14.00% | 18.51% | 23.88% | NA |
| Indica Intermediate | 786 | 47.20% | 20.20% | 23.79% | 8.78% | NA |
| Temperate Japonica | 767 | 97.90% | 0.10% | 0.39% | 1.56% | NA |
| Tropical Japonica | 504 | 34.30% | 0.00% | 15.87% | 49.80% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.80% | 8.30% | 15.35% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 13.54% | 4.17% | NA |
| Intermediate | 90 | 57.80% | 8.90% | 23.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904657901 | G -> DEL | LOC_Os09g08830.1 | N | frameshift_variant | Average:29.07; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0904657901 | G -> A | LOC_Os09g08830.1 | missense_variant ; p.Gly655Ser; MODERATE | nonsynonymous_codon ; G655S | Average:29.07; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904657901 | NA | 4.78E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904657901 | NA | 1.79E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904657901 | NA | 3.33E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904657901 | NA | 2.58E-07 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904657901 | 1.17E-06 | 3.72E-09 | mr1347 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904657901 | 4.35E-06 | 4.35E-06 | mr1596 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |