\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904650982:

Variant ID: vg0904650982 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4650982
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


CACCGATCCGGCAGCGGCGGCTCTCCCCCGCACAGATCTGTCGTCGCGGCCCTCCCCCTCCACAGATCTGGTGGTGGCGGCAGGGGGCGACGTGCATTCA[C/A]
CATCTCCGCCATCGTCGGCCTCCCCCTCCCTCACAGATCCGGCAACAGCGGCATCCATCCTCACAGATCTGGTGATGGCGGACTGCTACGGTGGTGATGA

Reverse complement sequence

TCATCACCACCGTAGCAGTCCGCCATCACCAGATCTGTGAGGATGGATGCCGCTGTTGCCGGATCTGTGAGGGAGGGGGAGGCCGACGATGGCGGAGATG[G/T]
TGAATGCACGTCGCCCCCTGCCGCCACCACCAGATCTGTGGAGGGGGAGGGCCGCGACGACAGATCTGTGCGGGGGAGAGCCGCCGCTGCCGGATCGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 35.90% 0.42% 0.04% NA
All Indica  2759 82.90% 16.60% 0.43% 0.04% NA
All Japonica  1512 35.30% 64.40% 0.33% 0.00% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 70.40% 29.10% 0.50% 0.00% NA
Indica II  465 81.30% 17.80% 0.65% 0.22% NA
Indica III  913 93.40% 6.50% 0.11% 0.00% NA
Indica Intermediate  786 81.20% 18.20% 0.64% 0.00% NA
Temperate Japonica  767 2.30% 97.40% 0.26% 0.00% NA
Tropical Japonica  504 80.00% 19.40% 0.60% 0.00% NA
Japonica Intermediate  241 46.50% 53.50% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 17.70% 1.04% 0.00% NA
Intermediate  90 66.70% 30.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904650982 C -> DEL N N silent_mutation Average:81.318; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0904650982 C -> A LOC_Os09g08810.1 upstream_gene_variant ; 3763.0bp to feature; MODIFIER silent_mutation Average:81.318; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0904650982 C -> A LOC_Os09g08820.1 upstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:81.318; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0904650982 C -> A LOC_Os09g08830.1 upstream_gene_variant ; 3969.0bp to feature; MODIFIER silent_mutation Average:81.318; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg0904650982 C -> A LOC_Os09g08810-LOC_Os09g08820 intergenic_region ; MODIFIER silent_mutation Average:81.318; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0904650982 C A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904650982 NA 4.85E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904650982 3.07E-06 6.22E-32 mr1208 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 2.51E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 7.16E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 1.02E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 6.65E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 9.51E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 8.43E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 2.67E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 3.69E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 4.95E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 4.56E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 3.84E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 1.51E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 7.51E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 2.79E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 1.58E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 1.61E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 3.05E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 1.37E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904650982 NA 5.73E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251