Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904643511:

Variant ID: vg0904643511 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4643511
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTATCAAGAAGTGCGATGGAACCAATTTTCAATGTCGTTCGGGTTTGTTGCCTCAATCTGTTATTGCTATTTGATTGATTTCTAATTCTAGATTAACC[T/G]
GCTGGAATTTTTCTATGTTTGTGTGTTGGTCGGCTGAGATCAAGACGAAATCGTCGCCGACGCCTTCACGCGTCGAGATTTTCTTCACGCGATCCAAACA

Reverse complement sequence

TGTTTGGATCGCGTGAAGAAAATCTCGACGCGTGAAGGCGTCGGCGACGATTTCGTCTTGATCTCAGCCGACCAACACACAAACATAGAAAAATTCCAGC[A/C]
GGTTAATCTAGAATTAGAAATCAATCAAATAGCAATAACAGATTGAGGCAACAAACCCGAACGACATTGAAAATTGGTTCCATCGCACTTCTTGATAGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 7.70% 1.46% 49.62% NA
All Indica  2759 22.70% 13.00% 2.10% 62.27% NA
All Japonica  1512 68.80% 0.10% 0.53% 30.49% NA
Aus  269 83.60% 0.00% 0.37% 15.99% NA
Indica I  595 30.60% 9.40% 2.18% 57.82% NA
Indica II  465 25.20% 25.20% 2.15% 47.53% NA
Indica III  913 9.60% 15.20% 1.75% 73.38% NA
Indica Intermediate  786 30.30% 5.90% 2.42% 61.45% NA
Temperate Japonica  767 97.70% 0.00% 0.00% 2.35% NA
Tropical Japonica  504 30.60% 0.20% 0.99% 68.25% NA
Japonica Intermediate  241 57.30% 0.40% 1.24% 41.08% NA
VI/Aromatic  96 25.00% 0.00% 1.04% 73.96% NA
Intermediate  90 37.80% 3.30% 1.11% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904643511 T -> G LOC_Os09g08790.1 downstream_gene_variant ; 3528.0bp to feature; MODIFIER silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 99.263 N N N N
vg0904643511 T -> G LOC_Os09g08810.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 99.263 N N N N
vg0904643511 T -> G LOC_Os09g08790-LOC_Os09g08810 intergenic_region ; MODIFIER silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 99.263 N N N N
vg0904643511 T -> DEL N N silent_mutation Average:55.949; most accessible tissue: Zhenshan97 flower, score: 99.263 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0904643511 T G -0.03 0.01 0.0 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904643511 3.67E-06 5.16E-13 mr1533 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 8.02E-06 mr1544 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 3.11E-06 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 1.67E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 5.83E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 2.08E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 6.33E-06 6.33E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 2.60E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 4.24E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 1.53E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 2.09E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 4.30E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 2.52E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 4.19E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 4.18E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 7.67E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 2.16E-06 2.16E-06 mr1466_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 8.52E-06 2.93E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 5.42E-06 1.11E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 6.80E-06 6.80E-06 mr1506_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 4.76E-06 1.52E-06 mr1556_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 1.71E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 8.64E-06 8.64E-06 mr1636_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 3.63E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 4.17E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 8.77E-06 NA mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 9.81E-07 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 4.54E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 8.61E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 8.00E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 3.83E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 3.75E-06 3.11E-11 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 9.32E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 1.88E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 5.12E-06 NA mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904643511 NA 6.05E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251