\
| Variant ID: vg0904574302 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 4574302 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATAGGTTGGGGAAGAAAACTTGAGGGAGATTAATTCTAATTATTTATTTTGTTAACCCCAATAACTAATACTCCCTCCGTCCCAAAATATAAGGGATTTT[G/A,T]
GTTGGATAGACTCTATCCATATTCGTAGTACTAGAATGTGTTACATTCAACCAAAATCTCTTATATTTTGGGACAATGGGAGTTCTAGGCATATCTCTTC
GAAGAGATATGCCTAGAACTCCCATTGTCCCAAAATATAAGAGATTTTGGTTGAATGTAACACATTCTAGTACTACGAATATGGATAGAGTCTATCCAAC[C/T,A]
AAAATCCCTTATATTTTGGGACGGAGGGAGTATTAGTTATTGGGGTTAACAAAATAAATAATTAGAATTAATCTCCCTCAAGTTTTCTTCCCCAACCTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 12.30% | 0.19% | 0.00% | T: 0.02% |
| All Indica | 2759 | 97.30% | 2.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 67.50% | 31.90% | 0.46% | 0.00% | T: 0.07% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 1.40% | 0.78% | 0.00% | T: 0.13% |
| Tropical Japonica | 504 | 20.60% | 79.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.70% | 29.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904574302 | G -> T | LOC_Os09g08710.1 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> T | LOC_Os09g08710.3 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> T | LOC_Os09g08710.2 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> T | LOC_Os09g08690.1 | downstream_gene_variant ; 4639.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> T | LOC_Os09g08700.1 | downstream_gene_variant ; 1674.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> T | LOC_Os09g08700-LOC_Os09g08710 | intergenic_region ; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> A | LOC_Os09g08710.1 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> A | LOC_Os09g08710.3 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> A | LOC_Os09g08710.2 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> A | LOC_Os09g08690.1 | downstream_gene_variant ; 4639.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> A | LOC_Os09g08700.1 | downstream_gene_variant ; 1674.0bp to feature; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| vg0904574302 | G -> A | LOC_Os09g08700-LOC_Os09g08710 | intergenic_region ; MODIFIER | silent_mutation | Average:44.655; most accessible tissue: Callus, score: 73.102 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904574302 | NA | 8.26E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0904574302 | NA | 3.23E-19 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.52E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.88E-08 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 1.80E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 1.67E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 5.08E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 1.26E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | 3.01E-06 | NA | mr1758 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.34E-08 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.64E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 4.10E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.63E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.35E-10 | mr1471_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.34E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.51E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 5.07E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 7.70E-10 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.04E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 7.12E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904574302 | NA | 2.01E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |