\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904574302:

Variant ID: vg0904574302 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4574302
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGGTTGGGGAAGAAAACTTGAGGGAGATTAATTCTAATTATTTATTTTGTTAACCCCAATAACTAATACTCCCTCCGTCCCAAAATATAAGGGATTTT[G/A,T]
GTTGGATAGACTCTATCCATATTCGTAGTACTAGAATGTGTTACATTCAACCAAAATCTCTTATATTTTGGGACAATGGGAGTTCTAGGCATATCTCTTC

Reverse complement sequence

GAAGAGATATGCCTAGAACTCCCATTGTCCCAAAATATAAGAGATTTTGGTTGAATGTAACACATTCTAGTACTACGAATATGGATAGAGTCTATCCAAC[C/T,A]
AAAATCCCTTATATTTTGGGACGGAGGGAGTATTAGTTATTGGGGTTAACAAAATAAATAATTAGAATTAATCTCCCTCAAGTTTTCTTCCCCAACCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.30% 0.19% 0.00% T: 0.02%
All Indica  2759 97.30% 2.70% 0.04% 0.00% NA
All Japonica  1512 67.50% 31.90% 0.46% 0.00% T: 0.07%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.40% 6.60% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.20% 0.13% 0.00% NA
Temperate Japonica  767 97.70% 1.40% 0.78% 0.00% T: 0.13%
Tropical Japonica  504 20.60% 79.40% 0.00% 0.00% NA
Japonica Intermediate  241 69.70% 29.90% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904574302 G -> T LOC_Os09g08710.1 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> T LOC_Os09g08710.3 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> T LOC_Os09g08710.2 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> T LOC_Os09g08690.1 downstream_gene_variant ; 4639.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> T LOC_Os09g08700.1 downstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> T LOC_Os09g08700-LOC_Os09g08710 intergenic_region ; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> A LOC_Os09g08710.1 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> A LOC_Os09g08710.3 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> A LOC_Os09g08710.2 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> A LOC_Os09g08690.1 downstream_gene_variant ; 4639.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> A LOC_Os09g08700.1 downstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N
vg0904574302 G -> A LOC_Os09g08700-LOC_Os09g08710 intergenic_region ; MODIFIER silent_mutation Average:44.655; most accessible tissue: Callus, score: 73.102 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904574302 NA 8.26E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904574302 NA 3.23E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.52E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.88E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 1.80E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 1.67E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 5.08E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 1.26E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 3.01E-06 NA mr1758 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.34E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.64E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 4.10E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.63E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.35E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.34E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.51E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 5.07E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 7.70E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.04E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 7.12E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904574302 NA 2.01E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251