\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904356037:

Variant ID: vg0904356037 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4356037
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCAGGGGTGTGCCCCCGTATGCAAAAATAGCGATTTTTCCAGACGCTCTACTGCACGCGAAAATAGGTTATGGGCCGCCTGGAAAAAGCCTTTCTATA[G/A]
TAGTGGAATGTATTAGTAATATTGTGGTGTTTACTAGAGTTATAATAGGTGATAGAAGTTGTAGCTGAAATAGGTGTCAAATATATTAGTCCTAATAGAG

Reverse complement sequence

CTCTATTAGGACTAATATATTTGACACCTATTTCAGCTACAACTTCTATCACCTATTATAACTCTAGTAAACACCACAATATTACTAATACATTCCACTA[C/T]
TATAGAAAGGCTTTTTCCAGGCGGCCCATAACCTATTTTCGCGTGCAGTAGAGCGTCTGGAAAAATCGCTATTTTTGCATACGGGGGCACACCCCTGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.40% 0.06% 0.00% NA
All Indica  2759 58.30% 41.60% 0.07% 0.00% NA
All Japonica  1512 94.10% 5.80% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 86.70% 12.90% 0.34% 0.00% NA
Indica II  465 64.50% 35.50% 0.00% 0.00% NA
Indica III  913 27.90% 72.10% 0.00% 0.00% NA
Indica Intermediate  786 68.40% 31.60% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 72.60% 27.40% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904356037 G -> A LOC_Os09g08390.1 upstream_gene_variant ; 811.0bp to feature; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N
vg0904356037 G -> A LOC_Os09g08390.2 upstream_gene_variant ; 2715.0bp to feature; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N
vg0904356037 G -> A LOC_Os09g08390.3 upstream_gene_variant ; 811.0bp to feature; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N
vg0904356037 G -> A LOC_Os09g08390.5 upstream_gene_variant ; 811.0bp to feature; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N
vg0904356037 G -> A LOC_Os09g08390.4 upstream_gene_variant ; 811.0bp to feature; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N
vg0904356037 G -> A LOC_Os09g08400.1 downstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N
vg0904356037 G -> A LOC_Os09g08390-LOC_Os09g08400 intergenic_region ; MODIFIER silent_mutation Average:77.815; most accessible tissue: Minghui63 root, score: 92.748 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0904356037 G A 0.01 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904356037 NA 9.05E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904356037 2.34E-06 2.34E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 1.33E-07 1.33E-07 mr1009 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 7.37E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 4.72E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 1.16E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 2.27E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 3.88E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 8.15E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 1.38E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904356037 NA 4.24E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251