Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904348676:

Variant ID: vg0904348676 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 4348676
Reference Allele: GTAlternative Allele: TT,G,GTT
Primary Allele: TTSecondary Allele: GT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAAAACTATCGCTGGCGGTGATGGATTGTTCATTAGCAATTTCGGAGTATTTAGGTTCTATTTAATTTGTTTATGTTTATAAGCTAGCTTATGAGG[GT/TT,G,GTT]
TTTTTTTTTTTGCGGGGGAGCTAGCTTATGAGTTGAAAAGTCTAAATCTGAGCAAAACAATGTTTTTTGGCTTTTTTAAAGCCATAACCCACTCTTATAC

Reverse complement sequence

GTATAAGAGTGGGTTATGGCTTTAAAAAAGCCAAAAAACATTGTTTTGCTCAGATTTAGACTTTTCAACTCATAAGCTAGCTCCCCCGCAAAAAAAAAAA[AC/AA,C,AAC]
CCTCATAAGCTAGCTTATAAACATAAACAAATTAAATAGAACCTAAATACTCCGAAATTGCTAATGAACAATCCATCACCGCCAGCGATAGTTTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of TT(primary allele) Frequency of GT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.20% 29.20% 9.48% 29.86% GTT: 0.21%; G: 0.04%
All Indica  2759 47.00% 4.90% 6.78% 41.28% NA
All Japonica  1512 5.90% 73.20% 5.95% 14.22% GTT: 0.60%; G: 0.13%
Aus  269 21.60% 35.30% 41.64% 1.12% GTT: 0.37%
Indica I  595 78.80% 6.10% 2.18% 12.94% NA
Indica II  465 45.80% 4.90% 13.33% 35.91% NA
Indica III  913 21.70% 2.00% 4.71% 71.63% NA
Indica Intermediate  786 53.20% 7.40% 8.78% 30.66% NA
Temperate Japonica  767 1.30% 94.90% 2.35% 0.65% GTT: 0.65%; G: 0.13%
Tropical Japonica  504 6.00% 45.20% 10.91% 37.50% GTT: 0.20%; G: 0.20%
Japonica Intermediate  241 20.30% 62.70% 7.05% 8.71% GTT: 1.24%
VI/Aromatic  96 5.20% 13.50% 47.92% 33.33% NA
Intermediate  90 25.60% 35.60% 14.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904348676 GT -> G LOC_Os09g08370.1 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08370.2 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08370.3 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08379.1 downstream_gene_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08390.1 downstream_gene_variant ; 887.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08390.2 downstream_gene_variant ; 887.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08390.3 downstream_gene_variant ; 887.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08390.5 downstream_gene_variant ; 1910.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08390.4 downstream_gene_variant ; 1939.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> G LOC_Os09g08379-LOC_Os09g08390 intergenic_region ; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08370.1 upstream_gene_variant ; 2895.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08370.2 upstream_gene_variant ; 2895.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08370.3 upstream_gene_variant ; 2895.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08379.1 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08390.1 downstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08390.2 downstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08390.3 downstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08390.5 downstream_gene_variant ; 1911.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08390.4 downstream_gene_variant ; 1940.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> TT LOC_Os09g08379-LOC_Os09g08390 intergenic_region ; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08370.1 upstream_gene_variant ; 2897.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08370.2 upstream_gene_variant ; 2897.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08370.3 upstream_gene_variant ; 2897.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08379.1 downstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08390.1 downstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08390.2 downstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08390.3 downstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08390.5 downstream_gene_variant ; 1909.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08390.4 downstream_gene_variant ; 1938.0bp to feature; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> GTT LOC_Os09g08379-LOC_Os09g08390 intergenic_region ; MODIFIER silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N
vg0904348676 GT -> DEL N N silent_mutation Average:59.454; most accessible tissue: Callus, score: 82.321 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904348676 NA 3.06E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0904348676 NA 3.66E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 3.00E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 1.13E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 2.49E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 7.58E-09 mr1371_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 3.09E-06 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 5.94E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 4.85E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 1.33E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 6.03E-09 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 5.68E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 4.40E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 9.07E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 2.90E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 1.96E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 3.80E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904348676 NA 5.01E-09 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251