\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904311002:

Variant ID: vg0904311002 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4311002
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTCATGCAGGTGGCAAAGAAACGATTGGCGAAGGAAGTATGGGATTGTCTCAAGACAAGATTCGTGGGTGCTGATCGACTGCGTGACGCGCGGCTG[T/C]
AGACGCTGAAGGGCGAATTCGGCGCCATGGTGATGGAGCCGGGGGAAACCCTGGATCAGTACGCAGGCCGCATCACCACGATGAGCGTGCGCCACTCGGC

Reverse complement sequence

GCCGAGTGGCGCACGCTCATCGTGGTGATGCGGCCTGCGTACTGATCCAGGGTTTCCCCCGGCTCCATCACCATGGCGCCGAATTCGCCCTTCAGCGTCT[A/G]
CAGCCGCGCGTCACGCAGTCGATCAGCACCCACGAATCTTGTCTTGAGACAATCCCATACTTCCTTCGCCAATCGTTTCTTTGCCACCTGCATGAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 34.60% 0.42% 25.24% NA
All Indica  2759 56.40% 3.00% 0.72% 39.80% NA
All Japonica  1512 0.90% 98.80% 0.00% 0.33% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 81.70% 5.50% 0.00% 12.77% NA
Indica II  465 63.40% 1.50% 0.22% 34.84% NA
Indica III  913 28.00% 1.80% 1.53% 68.67% NA
Indica Intermediate  786 66.20% 3.60% 0.64% 29.64% NA
Temperate Japonica  767 0.70% 99.20% 0.00% 0.13% NA
Tropical Japonica  504 1.00% 98.60% 0.00% 0.40% NA
Japonica Intermediate  241 1.20% 97.90% 0.00% 0.83% NA
VI/Aromatic  96 10.40% 16.70% 0.00% 72.92% NA
Intermediate  90 33.30% 45.60% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904311002 T -> DEL N N silent_mutation Average:42.518; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N
vg0904311002 T -> C LOC_Os09g08340.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:42.518; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N
vg0904311002 T -> C LOC_Os09g08330.1 downstream_gene_variant ; 4914.0bp to feature; MODIFIER silent_mutation Average:42.518; most accessible tissue: Zhenshan97 flower, score: 86.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904311002 5.59E-06 1.99E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 4.39E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 9.28E-07 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 2.15E-18 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 1.96E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 7.32E-06 1.04E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 1.20E-06 4.13E-07 mr1502_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 2.02E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 4.36E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 6.68E-06 2.69E-06 mr1677_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 3.12E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 1.43E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 6.73E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 6.63E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 1.58E-20 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 4.48E-17 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 3.14E-07 3.05E-08 mr1892_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 1.76E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904311002 NA 1.72E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251