Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904296667:

Variant ID: vg0904296667 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4296667
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AGTACAAGGCTCGGCTTGTTGTAAGGGCTACACTCAGAAAGAAGGCGAAGATTTCTTTGACATTTACTCACCTGTTGCTAGATTGACCACAATTCGTGTG[C/T]
TACTTTCCCTAGCAGCCCCACATGGTCTTCTCGTTCATCAAATGGACGTTAAGACAACTTTTCTTATTGGAGAGCCGGATGAGGAGATCTATATGGATCA

Reverse complement sequence

TGATCCATATAGATCTCCTCATCCGGCTCTCCAATAAGAAAAGTTGTCTTAACGTCCATTTGATGAACGAGAAGACCATGTGGGGCTGCTAGGGAAAGTA[G/A]
CACACGAATTGTGGTCAATCTAGCAACAGGTGAGTAAATGTCAAAGAAATCTTCGCCTTCTTTCTGAGTGTAGCCCTTACAACAAGCCGAGCCTTGTACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.30%	17.30%	1.35%	24.08%	NA
All Indica	2759	55.70%	4.20%	2.03%	38.06%	NA
All Japonica	1512	69.50%	30.10%	0.07%	0.33%	NA
Aus	269	19.00%	80.70%	0.00%	0.37%	NA
Indica I	595	86.70%	0.30%	0.50%	12.44%	NA
Indica II	465	58.70%	6.90%	2.58%	31.83%	NA
Indica III	913	27.70%	2.50%	3.94%	65.83%	NA
Indica Intermediate	786	63.00%	7.50%	0.64%	28.88%	NA
Temperate Japonica	767	98.70%	1.20%	0.00%	0.13%	NA
Tropical Japonica	504	20.60%	79.00%	0.00%	0.40%	NA
Japonica Intermediate	241	78.80%	19.90%	0.41%	0.83%	NA
VI/Aromatic	96	18.80%	8.30%	4.17%	68.75%	NA
Intermediate	90	55.60%	23.30%	3.33%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904296667	C -> DEL	N	N	silent_mutation	Average:22.131; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N
vg0904296667	C -> T	LOC_Os09g08310.1	intron_variant ; MODIFIER	silent_mutation	Average:22.131; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904296667	NA	4.31E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	3.90E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	3.80E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	3.16E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.27E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	8.27E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	7.50E-13	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	2.37E-13	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	3.11E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	2.38E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	6.18E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	7.38E-08	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	2.84E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	6.44E-13	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.41E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.94E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.71E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	5.59E-17	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.58E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	3.44E-14	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	2.34E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	4.83E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.06E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	5.97E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	4.46E-12	mr1808_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.21E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	1.43E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	9.74E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667	NA	2.76E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251