\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904296667:

Variant ID: vg0904296667 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4296667
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACAAGGCTCGGCTTGTTGTAAGGGCTACACTCAGAAAGAAGGCGAAGATTTCTTTGACATTTACTCACCTGTTGCTAGATTGACCACAATTCGTGTG[C/T]
TACTTTCCCTAGCAGCCCCACATGGTCTTCTCGTTCATCAAATGGACGTTAAGACAACTTTTCTTATTGGAGAGCCGGATGAGGAGATCTATATGGATCA

Reverse complement sequence

TGATCCATATAGATCTCCTCATCCGGCTCTCCAATAAGAAAAGTTGTCTTAACGTCCATTTGATGAACGAGAAGACCATGTGGGGCTGCTAGGGAAAGTA[G/A]
CACACGAATTGTGGTCAATCTAGCAACAGGTGAGTAAATGTCAAAGAAATCTTCGCCTTCTTTCTGAGTGTAGCCCTTACAACAAGCCGAGCCTTGTACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 17.30% 1.35% 24.08% NA
All Indica  2759 55.70% 4.20% 2.03% 38.06% NA
All Japonica  1512 69.50% 30.10% 0.07% 0.33% NA
Aus  269 19.00% 80.70% 0.00% 0.37% NA
Indica I  595 86.70% 0.30% 0.50% 12.44% NA
Indica II  465 58.70% 6.90% 2.58% 31.83% NA
Indica III  913 27.70% 2.50% 3.94% 65.83% NA
Indica Intermediate  786 63.00% 7.50% 0.64% 28.88% NA
Temperate Japonica  767 98.70% 1.20% 0.00% 0.13% NA
Tropical Japonica  504 20.60% 79.00% 0.00% 0.40% NA
Japonica Intermediate  241 78.80% 19.90% 0.41% 0.83% NA
VI/Aromatic  96 18.80% 8.30% 4.17% 68.75% NA
Intermediate  90 55.60% 23.30% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904296667 C -> DEL N N silent_mutation Average:22.131; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N
vg0904296667 C -> T LOC_Os09g08310.1 intron_variant ; MODIFIER silent_mutation Average:22.131; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904296667 NA 4.31E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 3.90E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 3.80E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 3.16E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.27E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 8.27E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 7.50E-13 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 2.37E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 3.11E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 2.38E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 6.18E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 7.38E-08 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 2.84E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 6.44E-13 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.41E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.94E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.71E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 5.59E-17 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.58E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 3.44E-14 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 2.34E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 4.83E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.06E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 5.97E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 4.46E-12 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.21E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 1.43E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 9.74E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904296667 NA 2.76E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251