\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904292547:

Variant ID: vg0904292547 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4292547
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCCTGTCTAATTACTAATTTGATGCATGTGCAACATGGCACTATACTCAGTAGTAGTTGTCATGCACTCATGCTTAATTGGCTGTTGGTTACATAC[G/T]
CTAACCAATTGTTTCGAAGACATTTTGATTAATTTGACCTCTGCTGAAATTAGGCAAATTTCCAAAAGCACATTTCAGTAGGCGAGACCATATCTGCCCT

Reverse complement sequence

AGGGCAGATATGGTCTCGCCTACTGAAATGTGCTTTTGGAAATTTGCCTAATTTCAGCAGAGGTCAAATTAATCAAAATGTCTTCGAAACAATTGGTTAG[C/A]
GTATGTAACCAACAGCCAATTAAGCATGAGTGCATGACAACTACTACTGAGTATAGTGCCATGTTGCACATGCATCAAATTAGTAATTAGACAGGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 18.10% 0.51% 25.18% NA
All Indica  2759 54.00% 5.50% 0.80% 39.72% NA
All Japonica  1512 69.40% 30.20% 0.07% 0.26% NA
Aus  269 19.00% 80.70% 0.00% 0.37% NA
Indica I  595 86.70% 0.30% 0.34% 12.61% NA
Indica II  465 51.40% 14.00% 0.43% 34.19% NA
Indica III  913 26.60% 2.50% 1.75% 69.11% NA
Indica Intermediate  786 62.60% 7.80% 0.25% 29.39% NA
Temperate Japonica  767 98.70% 1.20% 0.00% 0.13% NA
Tropical Japonica  504 20.80% 79.00% 0.00% 0.20% NA
Japonica Intermediate  241 78.00% 20.70% 0.41% 0.83% NA
VI/Aromatic  96 16.70% 9.40% 1.04% 72.92% NA
Intermediate  90 56.70% 22.20% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904292547 G -> DEL N N silent_mutation Average:24.493; most accessible tissue: Callus, score: 70.342 N N N N
vg0904292547 G -> T LOC_Os09g08290.1 upstream_gene_variant ; 3932.0bp to feature; MODIFIER silent_mutation Average:24.493; most accessible tissue: Callus, score: 70.342 N N N N
vg0904292547 G -> T LOC_Os09g08310.1 upstream_gene_variant ; 1399.0bp to feature; MODIFIER silent_mutation Average:24.493; most accessible tissue: Callus, score: 70.342 N N N N
vg0904292547 G -> T LOC_Os09g08300.1 downstream_gene_variant ; 921.0bp to feature; MODIFIER silent_mutation Average:24.493; most accessible tissue: Callus, score: 70.342 N N N N
vg0904292547 G -> T LOC_Os09g08300-LOC_Os09g08310 intergenic_region ; MODIFIER silent_mutation Average:24.493; most accessible tissue: Callus, score: 70.342 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904292547 NA 7.47E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 8.40E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 6.35E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 3.66E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 1.61E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 4.75E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 2.13E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 5.71E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 5.31E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 4.13E-07 4.13E-07 mr1177_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 2.55E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 1.16E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 2.42E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 1.07E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 2.49E-11 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 1.33E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 1.54E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 1.66E-12 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 4.47E-22 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 6.82E-12 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 6.69E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 8.08E-10 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 2.19E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 2.89E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547 NA 3.41E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251