Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904292547:

Variant ID: vg0904292547 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4292547
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTCCTGTCTAATTACTAATTTGATGCATGTGCAACATGGCACTATACTCAGTAGTAGTTGTCATGCACTCATGCTTAATTGGCTGTTGGTTACATAC[G/T]
CTAACCAATTGTTTCGAAGACATTTTGATTAATTTGACCTCTGCTGAAATTAGGCAAATTTCCAAAAGCACATTTCAGTAGGCGAGACCATATCTGCCCT

Reverse complement sequence

AGGGCAGATATGGTCTCGCCTACTGAAATGTGCTTTTGGAAATTTGCCTAATTTCAGCAGAGGTCAAATTAATCAAAATGTCTTCGAAACAATTGGTTAG[C/A]
GTATGTAACCAACAGCCAATTAAGCATGAGTGCATGACAACTACTACTGAGTATAGTGCCATGTTGCACATGCATCAAATTAGTAATTAGACAGGAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	18.10%	0.51%	25.18%	NA
All Indica	2759	54.00%	5.50%	0.80%	39.72%	NA
All Japonica	1512	69.40%	30.20%	0.07%	0.26%	NA
Aus	269	19.00%	80.70%	0.00%	0.37%	NA
Indica I	595	86.70%	0.30%	0.34%	12.61%	NA
Indica II	465	51.40%	14.00%	0.43%	34.19%	NA
Indica III	913	26.60%	2.50%	1.75%	69.11%	NA
Indica Intermediate	786	62.60%	7.80%	0.25%	29.39%	NA
Temperate Japonica	767	98.70%	1.20%	0.00%	0.13%	NA
Tropical Japonica	504	20.80%	79.00%	0.00%	0.20%	NA
Japonica Intermediate	241	78.00%	20.70%	0.41%	0.83%	NA
VI/Aromatic	96	16.70%	9.40%	1.04%	72.92%	NA
Intermediate	90	56.70%	22.20%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904292547	G -> DEL	N	N	silent_mutation	Average:24.493; most accessible tissue: Callus, score: 70.342	N	N	N	N
vg0904292547	G -> T	LOC_Os09g08290.1	upstream_gene_variant ; 3932.0bp to feature; MODIFIER	silent_mutation	Average:24.493; most accessible tissue: Callus, score: 70.342	N	N	N	N
vg0904292547	G -> T	LOC_Os09g08310.1	upstream_gene_variant ; 1399.0bp to feature; MODIFIER	silent_mutation	Average:24.493; most accessible tissue: Callus, score: 70.342	N	N	N	N
vg0904292547	G -> T	LOC_Os09g08300.1	downstream_gene_variant ; 921.0bp to feature; MODIFIER	silent_mutation	Average:24.493; most accessible tissue: Callus, score: 70.342	N	N	N	N
vg0904292547	G -> T	LOC_Os09g08300-LOC_Os09g08310	intergenic_region ; MODIFIER	silent_mutation	Average:24.493; most accessible tissue: Callus, score: 70.342	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904292547	NA	7.47E-16	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	8.40E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	6.35E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	3.66E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	1.61E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	4.75E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	2.13E-15	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	5.71E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	5.31E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	4.13E-07	4.13E-07	mr1177_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	2.55E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	1.16E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	2.42E-16	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	1.07E-11	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	2.49E-11	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	1.33E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	1.54E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	1.66E-12	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	4.47E-22	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	6.82E-12	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	6.69E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	8.08E-10	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	2.19E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	2.89E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904292547	NA	3.41E-07	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251