\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904245458:

Variant ID: vg0904245458 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4245458
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGCAGTGGTGACCAAGTTGGCCACGTCGTCTAGCCAGCGCTGAACAGGGGTCTCCGGCTCCGAGTTCACGGGGGGATGCCGCAGAAGGGCGCCCGCCG[C/T]
CTGAAGCGTGCCTCGGGGTGAGCCGCCATCACCGTAAGTGAGGCGGCGCCGTGCCCCGACGCGTCGTGGCCTCTCTTCGCCCAGGGGCGGGGAGAGGGCC

Reverse complement sequence

GGCCCTCTCCCCGCCCCTGGGCGAAGAGAGGCCACGACGCGTCGGGGCACGGCGCCGCCTCACTTACGGTGATGGCGGCTCACCCCGAGGCACGCTTCAG[G/A]
CGGCGGGCGCCCTTCTGCGGCATCCCCCCGTGAACTCGGAGCCGGAGACCCCTGTTCAGCGCTGGCTAGACGACGTGGCCAACTTGGTCACCACTGCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 8.30% 7.70% 16.84% NA
All Indica  2759 73.80% 0.40% 7.32% 18.56% NA
All Japonica  1512 59.00% 23.70% 2.25% 15.01% NA
Aus  269 55.40% 0.00% 44.24% 0.37% NA
Indica I  595 89.10% 0.20% 1.68% 9.08% NA
Indica II  465 74.00% 0.20% 4.95% 20.86% NA
Indica III  913 60.70% 0.30% 12.71% 26.29% NA
Indica Intermediate  786 77.20% 0.60% 6.74% 15.39% NA
Temperate Japonica  767 79.00% 0.90% 1.17% 18.90% NA
Tropical Japonica  504 28.60% 65.10% 3.37% 2.98% NA
Japonica Intermediate  241 58.90% 10.00% 3.32% 27.80% NA
VI/Aromatic  96 42.70% 7.30% 4.17% 45.83% NA
Intermediate  90 64.40% 16.70% 5.56% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904245458 C -> DEL LOC_Os09g08180.1 N frameshift_variant Average:81.371; most accessible tissue: Zhenshan97 flag leaf, score: 93.287 N N N N
vg0904245458 C -> T LOC_Os09g08180.1 missense_variant ; p.Ala90Thr; MODERATE nonsynonymous_codon ; A90T Average:81.371; most accessible tissue: Zhenshan97 flag leaf, score: 93.287 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0904245458 C T 0.0 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904245458 NA 8.39E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 3.71E-23 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 3.95E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.45E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.45E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 5.27E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.16E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 5.31E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 4.45E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 8.85E-23 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 3.71E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 3.06E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 2.54E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 4.74E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.43E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 5.68E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 6.99E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.92E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.38E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 4.18E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.38E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 4.71E-06 NA mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 1.21E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904245458 NA 8.91E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251